View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9737_low_37 (Length: 238)
Name: NF9737_low_37
Description: NF9737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9737_low_37 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 29434875 - 29435096
Alignment:
| Q |
1 |
cctatattttagcaaactttatttcatcattcccattcctggttgttattgctcttacttcttgcacaatcacatatagcatggtgaaattcaggccagg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29434875 |
cctatattttagcaaactttatttcatcattcccattcctggttgttattgctcttacttcttgcacaatcacatataacatggtgaaattcaggccagg |
29434974 |
T |
|
| Q |
101 |
attcattcactatgtgtttttcactcttaacgtctatggatgcctctcagtgatcgagagtatcatgatggttgtagcttcgcttgttccaaatttcctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29434975 |
attcattcactatgtgtttttcactcttaacgtctatggatgcctctcagtgatcgagagtatcatgatggttgtagcttcgcttgttccaaatttcctt |
29435074 |
T |
|
| Q |
201 |
atgggaatcgttacaggagctg |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
29435075 |
atgggaatcgttacaggagctg |
29435096 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 5 - 222
Target Start/End: Original strand, 29468102 - 29468319
Alignment:
| Q |
5 |
tattttagcaaactttatttcatcattcccattcctggttgttattgctcttacttcttgcacaatcacatatagcatggtgaaattcaggccaggattc |
104 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| ||||||||||||||| || |||||| |
|
|
| T |
29468102 |
tattttatcaaactttctttcatcattcccattcttggttgctattgctcttacttcttgcacaatcacatataacatggtgaaattcagacccggattc |
29468201 |
T |
|
| Q |
105 |
attcactatgtgtttttcactcttaacgtctatggatgcctctcagtgatcgagagtatcatgatggttgtagcttcgcttgttccaaatttccttatgg |
204 |
Q |
| |
|
|||||||||| |||||||||| ||||| |||| |||||| |||||||||| |||||| ||||||||||||||||| | |||||||||||||| || |||| |
|
|
| T |
29468202 |
attcactatgcgtttttcactattaacatctacggatgcatctcagtgattgagagtctcatgatggttgtagctgcacttgttccaaattttctcatgg |
29468301 |
T |
|
| Q |
205 |
gaatcgttacaggagctg |
222 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
29468302 |
gaatcattacaggagctg |
29468319 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University