View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9737_low_44 (Length: 205)
Name: NF9737_low_44
Description: NF9737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9737_low_44 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 12 - 155
Target Start/End: Original strand, 3075922 - 3076065
Alignment:
| Q |
12 |
gagcacagagcaaccacacgattgagttggacacgacactttaactcaaaatcttaaggcaattttaaacaattatgctacaatcatacgagcttaatcg |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3075922 |
gagctcagagcaaccacacgattgagttggacacgacactttaactcaaaatcttaaggcaattttaaacaattatgctacaatcatacgagcttaatcg |
3076021 |
T |
|
| Q |
112 |
caataagtattcactgtaagtttgggtttgctataataactaac |
155 |
Q |
| |
|
|| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3076022 |
cagtaagtatccactgtaagtttgggtttgctataataactaac |
3076065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 17 - 72
Target Start/End: Complemental strand, 2336761 - 2336706
Alignment:
| Q |
17 |
cagagcaaccacacgattgagttggacacgacactttaactcaaaatcttaaggca |
72 |
Q |
| |
|
|||||||||||||| | |||||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
2336761 |
cagagcaaccacacaagtgagttggacaccacatcttaacccaaaatcttaaggca |
2336706 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University