View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9738_high_10 (Length: 249)
Name: NF9738_high_10
Description: NF9738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9738_high_10 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 6 - 249
Target Start/End: Original strand, 14271373 - 14271616
Alignment:
| Q |
6 |
tttggaggtaactaaccatagcatcacagcagaagccaaagaaagacgaaagaatccccaaagattcctaaacgcttcaaaagaaaatccattccaagct |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
14271373 |
tttggagttaactaaccatagcatcacagcagaagccaaagaaagacgaaagaatccccaaaggttcctaaacgcttcaaaagaaaatccattccaagct |
14271472 |
T |
 |
| Q |
106 |
ataccacatttcccactaaacacataccccaattgagccaccacaatgaaccaccatgagccattaagactcaccgcagcacccaccaatccccacccaa |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14271473 |
ataccacatttcccactaaacacataccccaattgagccaccacaatgaaccaccatgagccattaagactcaccgcagcacccaccaatccccacccaa |
14271572 |
T |
 |
| Q |
206 |
atttaaccatcaacaaccaactaaacaccggatgcaacaccatt |
249 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
14271573 |
atttaaccatcagcaaccaactaaacaccggatgcaacaccatt |
14271616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University