View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9738_low_5 (Length: 372)
Name: NF9738_low_5
Description: NF9738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9738_low_5 |
 |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold2098 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0112 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 33)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 71 - 354
Target Start/End: Original strand, 44105196 - 44105471
Alignment:
| Q |
71 |
aggtaccaaattaatgacaagaaaagtatattacttgtcaacaattgagatttatttgttggattgagtcgtgtctattggaggaaaatgcaagtcagcg |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44105196 |
aggtaccaaattaatgacaagaaaagtatattatttgtaaacaattgagatttatttgttggattgagtcgtgtctattggaggaaaatgcaagtcagcg |
44105295 |
T |
 |
| Q |
171 |
gtgaggggtctgttttaggattcatctttcnnnnnnnnnnnnnnnnatccctacaatgatacaatttcttctcttatatctcatcaaaggtaaaaggttc |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44105296 |
gtgaggggtctgttttaggattcatctttc-----attttttttttatccctaca---atacaatttcttctcttatatctcatcaaaggtaaaaggttc |
44105387 |
T |
 |
| Q |
271 |
acacatgtccctcccagaattatgaaaaatgatggccatagcaattcaccaaacgggctcattacaggaagccatgaaaaccct |
354 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44105388 |
acacatgtccctccaagaattatgaaaaatgatggccatagcaattcaccaaacgggctcattacaggaagccatgaaaaccct |
44105471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 9625028 - 9624975
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
9625028 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggaca |
9624975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 10959178 - 10959125
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||| ||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
10959178 |
ccctatatataataatgcattgtccctgccaactgagctatgctcacggggaca |
10959125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 27183731 - 27183784
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
27183731 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggaca |
27183784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 14868730 - 14868678
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
14868730 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggac |
14868678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 47191418 - 47191366
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
47191418 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggac |
47191366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 41767818 - 41767871
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| |||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
41767818 |
ccctgcatataacaatgcattgttcctgccaactgaactatgctcacggggaca |
41767871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 28226237 - 28226289
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||||| ||||||||||| |||| |||||||||| |
|
|
| T |
28226237 |
ccctgcatataataatgcattgttcctgccaactgagttatgttcacggggac |
28226289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 39298022 - 39298069
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
39298022 |
catataataatgcattgtccccgccaactgagctatgctcacggggac |
39298069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 64
Target Start/End: Complemental strand, 34136808 - 34136763
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcac |
64 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
34136808 |
ccctacatataataatgcattgttc-taccaactgagctatgctcac |
34136763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 43774230 - 43774176
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
|||| ||||||| |||||||||| | ||||||||||||||| ||||||||||||| |
|
|
| T |
43774230 |
ccctgcatataacaatgcattgtccctgccaactgagctatactcacggggacag |
43774176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 21 - 66
Target Start/End: Complemental strand, 48173328 - 48173284
Alignment:
| Q |
21 |
tacatataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
48173328 |
tacatataataatgcattgt-cttaccaactgagctatgctcacgg |
48173284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 49639073 - 49639025
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
49639073 |
ccctacatataataatgcattg-tcctaccaactgagctatgctcacggg |
49639025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 24 - 64
Target Start/End: Complemental strand, 3784109 - 3784069
Alignment:
| Q |
24 |
atataataatgcattgttcttgccaactgagctatgctcac |
64 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
3784109 |
atataataatgcattgtccctgccaactgagctatgctcac |
3784069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 19137664 - 19137613
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| ||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
19137664 |
ccctgcatataacaatgcat-gttcctgccaactgagctatgctcacggggac |
19137613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 36331776 - 36331824
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
|||| |||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
36331776 |
ccctgcatataataatgcattgtccctgccaattgagctatgctcacgg |
36331824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 36476404 - 36476352
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | |||||| |||| ||||||||||||||| |
|
|
| T |
36476404 |
ccctgcatataataatgcattgtccgtgccaattgagttatgctcacggggac |
36476352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 38555077 - 38555129
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
38555077 |
ccctgcatataataatgcattgtctctgccaactgaactatgctcacggggac |
38555129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 52030166 - 52030114
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||||||| |||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
52030166 |
ccctgcatataataatacattgtccctgccaactgagttatgctcacggggac |
52030114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 7448413 - 7448464
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgggga |
69 |
Q |
| |
|
|||| |||||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
7448413 |
ccctgcatataataatgcattgtccctatcaactgagctatgctcacgggga |
7448464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 69
Target Start/End: Original strand, 7456555 - 7456606
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgggga |
69 |
Q |
| |
|
|||| |||||||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
7456555 |
ccctgcatataataatgcattgtccctatcaactgagctatgctcacgggga |
7456606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 65
Target Start/End: Complemental strand, 31576556 - 31576509
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacg |
65 |
Q |
| |
|
|||| ||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
31576556 |
ccctgcatataacaatgcattgttcctaccaactgagctatgctcacg |
31576509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 42824041 - 42824088
Alignment:
| Q |
24 |
atataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||||||| ||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
42824041 |
atataataatgtattgtgcctgccaactgagttatgctcacggggaca |
42824088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 3955351 - 3955297
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
|||| |||||||||||||||||| | || ||| ||||||||||||||||| |||| |
|
|
| T |
3955351 |
ccctgcatataataatgcattgtccctgtcaattgagctatgctcacgggaacag |
3955297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 67
Target Start/End: Complemental strand, 44976616 - 44976570
Alignment:
| Q |
21 |
tacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||| | || |||||||| |||||||||||| |
|
|
| T |
44976616 |
tacatataataatgcattgtccctgtcaactgagttatgctcacggg |
44976570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 13540014 - 13540062
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | ||||||||||||| |||||||| |
|
|
| T |
13540014 |
ccctacatataataatgcattg-tcctaccaactgagctatactcacggg |
13540062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 16874240 - 16874292
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| ||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
16874240 |
ccctgcatataacaatgcat-gtccctgccaactgagctatgctcacggggaca |
16874292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 24559434 - 24559381
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||| ||||||| | | ||| |||||||||||||||||||||||| |
|
|
| T |
24559434 |
ccctgcatataattatgcattatccctgctaactgagctatgctcacggggaca |
24559381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 33206802 - 33206754
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
33206802 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
33206754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 25 - 66
Target Start/End: Original strand, 40557620 - 40557661
Alignment:
| Q |
25 |
tataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
40557620 |
tataacaatgcattgtccttgccaactgagttatgctcacgg |
40557661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 26 - 67
Target Start/End: Original strand, 46416281 - 46416321
Alignment:
| Q |
26 |
ataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
46416281 |
ataataatgcat-gtccttgccaactgagctatgctcacggg |
46416321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 12236644 - 12236593
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||||||||||| || | |||||||||||||| |||||||||||| |
|
|
| T |
12236644 |
ccctgcatataataatgcat-gtccctgccaactgagctacgctcacggggac |
12236593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 72
Target Start/End: Original strand, 53681906 - 53681946
Alignment:
| Q |
32 |
atgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
||||||||||||| ||||||||| || |||||||||||||| |
|
|
| T |
53681906 |
atgcattgttcttaccaactgaggtaagctcacggggacag |
53681946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 4e-17; HSPs: 32)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 38021297 - 38021244
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38021297 |
ccctgcatataataatgcattgtccttgccaactgagctatgctcacggggaca |
38021244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 71
Target Start/End: Complemental strand, 25819229 - 25819177
Alignment:
| Q |
19 |
cctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
25819229 |
cctacatataataatgcattgtccctgccaactgagctatgctcacggggaca |
25819177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 29491515 - 29491461
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
29491515 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggacag |
29491461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 39238761 - 39238708
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
39238761 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggaca |
39238708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 40678868 - 40678815
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
40678868 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggaca |
40678815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 17350106 - 17350053
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||| |||||||||||| |
|
|
| T |
17350106 |
ccctgcatataataatgcattgtccctgccaactgagctatactcacggggaca |
17350053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 29442018 - 29442070
Alignment:
| Q |
19 |
cctacatataataatgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
29442018 |
cctacatataataatgcattgtccta-ccaactgagctatgctcacggggacag |
29442070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 35111695 - 35111642
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
35111695 |
ccctgcatataataatgcattgttcctatcaactgagctatgctcacggggaca |
35111642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 47763435 - 47763484
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
47763435 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggg |
47763484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 2052732 - 2052784
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||| |||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
2052732 |
ccctgcatatgataatgcattgtccctgccaactgagctatgctcacggggac |
2052784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 9527471 - 9527419
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
9527471 |
ccctgcatataacaatgcattgtccctgccaactgagctatgctcacggggac |
9527419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 64
Target Start/End: Original strand, 13870131 - 13870177
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcac |
64 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
13870131 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcac |
13870177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 23 - 69
Target Start/End: Original strand, 25162716 - 25162762
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacgggga |
69 |
Q |
| |
|
|||||||||||||||||| | ||| |||||||||||||||||||||| |
|
|
| T |
25162716 |
catataataatgcattgtccctgctaactgagctatgctcacgggga |
25162762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 52961132 - 52961183
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| ||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
52961132 |
ccctgcatataacaatgcat-gtccttgccaactgagctatgctcacggggac |
52961183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 32 - 71
Target Start/End: Complemental strand, 5907831 - 5907792
Alignment:
| Q |
32 |
atgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
5907831 |
atgcattgtccttgccaactgagctaagctcacggggaca |
5907792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 17 - 67
Target Start/End: Original strand, 18923934 - 18923983
Alignment:
| Q |
17 |
accctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
18923934 |
accctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
18923983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 538379 - 538427
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
538379 |
ccctgcatataataatgcattgttc-taccaactgaactatgctcacggg |
538427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 3533023 - 3533071
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | | |||||||||||||||||||| |
|
|
| T |
3533023 |
ccctacatataataatgcattg-tcctactaactgagctatgctcacggg |
3533071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 9768859 - 9768911
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| ||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
9768859 |
ccctgcatataacaatgcat-gtccctgccaactgagctatgctcacggggaca |
9768911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 9769630 - 9769674
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctca |
63 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
9769630 |
ccctacatataataatgca-tgtccctgccaactgagctatgctca |
9769674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 15774362 - 15774410
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | ||||||||| |||||||||||| |
|
|
| T |
15774362 |
ccctacatataataatgcattg-tcctaccaactgagttatgctcacggg |
15774410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 18003861 - 18003809
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| ||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
18003861 |
ccctgcatataacaatgcat-gtccctgccaactgagctatgctcacggggaca |
18003809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 19976602 - 19976655
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| || |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
19976602 |
ccctgcatataaccatacattgtccctgccaactgagctatgctcacggggaca |
19976655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 38019998 - 38020046
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
38019998 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
38020046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 40814816 - 40814864
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
40814816 |
ccctgcatataataatgcattgt-cttactaactgagctatgctcacggg |
40814864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 17 - 62
Target Start/End: Original strand, 47939247 - 47939292
Alignment:
| Q |
17 |
accctacatataataatgcattgttcttgccaactgagctatgctc |
62 |
Q |
| |
|
||||| ||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
47939247 |
accctgcatataacaatgcattgtccctgccaactgagctatgctc |
47939292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 48110574 - 48110526
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||||||||| ||||||||| |
|
|
| T |
48110574 |
ccctgcatataataatgcattgttc-taccaactgagctacgctcacggg |
48110526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 52833156 - 52833205
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||| || ||||||||| |
|
|
| T |
52833156 |
ccctgcatataataatgcattgtccctgccaactgagttaggctcacggg |
52833205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 749636 - 749683
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
749636 |
ccctacatataataatgcattgttc-gaccaactgagttatgctcacgg |
749683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 4429532 - 4429579
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
4429532 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacgg |
4429579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 66
Target Start/End: Original strand, 24168629 - 24168676
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
||||||||||||||||||| ||||| | | ||||||||||||||||||| |
|
|
| T |
24168629 |
ccctacatataataatgca-tgttcctacaaactgagctatgctcacgg |
24168676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 32 - 72
Target Start/End: Original strand, 47528476 - 47528516
Alignment:
| Q |
32 |
atgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
||||||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
47528476 |
atgcattgtccttaccaactgagctaagctcacggggacag |
47528516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 45; Significance: 1e-16; HSPs: 20)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 6144010 - 6143958
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
6144010 |
ccctacatataataatgcattgtccctgccaactgagctatgctcacggggac |
6143958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 9064911 - 9064857
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
9064911 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggacag |
9064857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 14981752 - 14981804
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
14981752 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggac |
14981804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 2945641 - 2945588
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| |||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
2945641 |
ccctgcatataacaatgcattgtccctgccaactgagctatgctcacggggaca |
2945588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 22 - 70
Target Start/End: Original strand, 33628992 - 33629040
Alignment:
| Q |
22 |
acatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
33628992 |
acatataataatgcattgtccctgccaactgagctatgttcacggggac |
33629040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 18991529 - 18991481
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
18991529 |
ccctacatataataatgcattg-tcttaccaactgagctatgctcgcggg |
18991481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 29284163 - 29284110
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||||||||||||||| |||||||| | ||||||||| |||||||| ||||||| |
|
|
| T |
29284163 |
ccctacatataataatacattgttcctaccaactgagttatgctcatggggaca |
29284110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 71
Target Start/End: Complemental strand, 3448390 - 3448344
Alignment:
| Q |
25 |
tataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||| |||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
3448390 |
tataacaatgcattgtccctgccaattgagctatgctcacggggaca |
3448344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 4078701 - 4078655
Alignment:
| Q |
24 |
atataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||| |||||||||| | |||||||||| |||||||||||||||| |
|
|
| T |
4078701 |
atataacaatgcattgtccatgccaactgaactatgctcacggggac |
4078655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 24470447 - 24470493
Alignment:
| Q |
24 |
atataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
24470447 |
atataataatgcattgtctctgccaactgagctatgcttacggggac |
24470493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 9491785 - 9491833
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | ||||||||| |||||||||||| |
|
|
| T |
9491785 |
ccctacatataataatgcattg-tcctaccaactgagttatgctcacggg |
9491833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 12089142 - 12089094
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
12089142 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
12089094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 22389800 - 22389848
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
22389800 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
22389848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 31741513 - 31741557
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctca |
63 |
Q |
| |
|
|||||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
31741513 |
ccctacatataataatgcattg-tcctaccaactgagctatgctca |
31741557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 34524920 - 34524868
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| ||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
34524920 |
ccctgcatataacaatgcat-gtccctgccaactgagctatgctcacggggaca |
34524868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 35190808 - 35190764
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctca |
63 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
35190808 |
ccctgcatataataatgcattgttc-taccaactgagctatgctca |
35190764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 10455787 - 10455736
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| ||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
10455787 |
ccctgcatataacaatgcat-gttcctgccaactgaactatgctcacggggac |
10455736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 67
Target Start/End: Original strand, 19642602 - 19642645
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
19642602 |
catataataatgcattgtccta-ccaactgagctatgctcacggg |
19642645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 26669709 - 26669760
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||||| |||||| || | | ||||||||||||||||||||||||| |
|
|
| T |
26669709 |
ccctacatataattatgcat-gtccctaccaactgagctatgctcacggggac |
26669760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 31411112 - 31411159
Alignment:
| Q |
19 |
cctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||| ||||| || |||||||| |||||||||||| |
|
|
| T |
31411112 |
cctacatataataatgca-tgttcctgtcaactgagttatgctcacggg |
31411159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 36)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 53815741 - 53815687
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
53815741 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggacag |
53815687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 23 - 68
Target Start/End: Complemental strand, 34106642 - 34106597
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacgggg |
68 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
34106642 |
catataataatgcattgttcctgccaactgagctatgctcacgggg |
34106597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 8690259 - 8690207
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
8690259 |
ccctgcatataataatgcattgtccttgccaactgagctatgctcacgaggac |
8690207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 28520781 - 28520833
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
28520781 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggac |
28520833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 30152168 - 30152120
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30152168 |
catataacaatgcattgttcctgccaactgagctatgctcacggggaca |
30152120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 24 - 70
Target Start/End: Complemental strand, 40150512 - 40150466
Alignment:
| Q |
24 |
atataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
40150512 |
atataataatgcattgttcctgccaactgaactatgctcacggggac |
40150466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 9693007 - 9692954
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
9693007 |
ccctgcatataataatgcattatccctgccaactgagctatgctcacggggaca |
9692954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 14149838 - 14149785
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||| ||||||||||| |
|
|
| T |
14149838 |
ccctgcatataataatgcattgtccctgccaactgagctatggtcacggggaca |
14149785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 48512244 - 48512191
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| |||||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
48512244 |
ccctgcatataacaatgcattgtccctgccaactgagctatgctcacggggaca |
48512191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 36008320 - 36008268
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
36008320 |
ccctgcatataacaatgcattgtccctgccaactgagctatgctcacggggac |
36008268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 42411504 - 42411556
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||| ||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
42411504 |
ccctgcatataattatgcattgtccctgccaactgagctatgctcacggggac |
42411556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 48968260 - 48968312
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||| |||||||||||||||| |
|
|
| T |
48968260 |
ccctgcatataataatgcattgtccctgccaactgaactatgctcacggggac |
48968312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 56531286 - 56531338
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
56531286 |
ccctgcatataacaatgcattgtccttgccaactgagctatgctcacagggac |
56531338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 20753175 - 20753223
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||||||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
20753175 |
ccctacatataataatgcatt-ttcctaccaactgagctatgctcacggg |
20753223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 37032229 - 37032282
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| ||||||||||| |||||| |
|
|
| T |
37032229 |
ccctgcatataataatgcattgtccttgccaactatgctatgctcacagggaca |
37032282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 41492548 - 41492600
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||||||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
41492548 |
ccctgcatataataatgcat-gtccctgccaactgagctatgctcacggggaca |
41492600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 52031252 - 52031203
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||| ||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
52031252 |
ccctgcatatactaatgcattgttcctgccaactgagctaagctcacggg |
52031203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 55266485 - 55266533
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
55266485 |
ccctgcatataataatgcattgttc-taccaactgagctatgctcacggg |
55266533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 2565306 - 2565254
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| | || |||||||||||||||||||||||| |
|
|
| T |
2565306 |
ccctgcatataacaatgcattgtccctgtcaactgagctatgctcacggggac |
2565254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 12820455 - 12820507
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12820455 |
ccctgcatataacaatgcattgtctctgccaactgagctatgctcacggggac |
12820507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 46799448 - 46799400
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||||||||||||||||| | |||||||| | ||||||||||||||||| |
|
|
| T |
46799448 |
catataataatgcattgtgcctgccaactaaactatgctcacggggaca |
46799400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 15640498 - 15640545
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
15640498 |
catataataatgcattgtctctgccaactgagatatgctcacggggac |
15640545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 32 - 71
Target Start/End: Complemental strand, 16996494 - 16996455
Alignment:
| Q |
32 |
atgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
16996494 |
atgcattgttcttaccaactgagctaagctcacggggaca |
16996455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 18 - 57
Target Start/End: Complemental strand, 27296867 - 27296828
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagcta |
57 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
27296867 |
ccctatatataataatgcattgttcctgccaactgagcta |
27296828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 29269365 - 29269412
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
29269365 |
ccctacatataataatgcattgtcc--accaactgagctatgctcacggg |
29269412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 36954182 - 36954132
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaac-tgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||| ||||||||||||||||| |
|
|
| T |
36954182 |
ccctgcatataataatgcattgtccctgccaacttgagctatgctcacggg |
36954132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 9084804 - 9084759
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctca |
63 |
Q |
| |
|
|||| ||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
9084804 |
ccctgcatataacaatgcattgtccctgccaactgagctatgctca |
9084759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 17268613 - 17268661
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||| ||| |||| |||||||||| ||||||||||||| |
|
|
| T |
17268613 |
ccctacatataataatacat-gttcctgccaactgaactatgctcacggg |
17268661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 30616043 - 30615990
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| |||||||||| | || ||| ||||||||||||||||||||| |
|
|
| T |
30616043 |
ccctgcatataacaatgcattgtccatgtcaattgagctatgctcacggggaca |
30615990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 47017996 - 47018044
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
47017996 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
47018044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 49039495 - 49039547
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| ||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
49039495 |
ccctgcatataacaatgcat-gtccctgccaactgagctatgctcacggggaca |
49039547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 50657925 - 50657877
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
50657925 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
50657877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 54854229 - 54854281
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||| |||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
54854229 |
ccctgcatataattatgcat-gtccctgccaactgagctatgctcacggggaca |
54854281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 20181256 - 20181209
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
|||||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
20181256 |
ccctacatataatactgcattgtccta-ccaactgagctatgctcacgg |
20181209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 32885733 - 32885686
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
|||| |||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
32885733 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacgg |
32885686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 49319438 - 49319387
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||||||||||| || | |||||||||||||||||||||| |||| |
|
|
| T |
49319438 |
ccctgcatataataatgcat-gtccatgccaactgagctatgctcacgaggac |
49319387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 24)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 36045184 - 36045233
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36045184 |
ccctgcatataataatgcattgttcttgtcaactgagctatgctcacggg |
36045233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 20735225 - 20735277
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
20735225 |
ccctacatataataatgcattgtccctgccaactgagctatgttcacggggac |
20735277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 37303979 - 37303926
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||||||| |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
37303979 |
ccctgcatataataatacattgtccctgccaactgagctatgctcacggggaca |
37303926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 1463916 - 1463864
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
1463916 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacagggac |
1463864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 19 - 70
Target Start/End: Original strand, 3102178 - 3102229
Alignment:
| Q |
19 |
cctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
3102178 |
cctacatataacaatgcattgtccctgccaactgagctatgcttacggggac |
3102229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 23 - 70
Target Start/End: Complemental strand, 5156937 - 5156890
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||| |||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
5156937 |
catataacaatgcattgttcatgtcaactgagctatgctcacggggac |
5156890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 72
Target Start/End: Original strand, 6806690 - 6806744
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
|||| ||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6806690 |
ccctgcatataacaatgcattgtctctgccaactgagctatgctcacggggacag |
6806744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 6447530 - 6447579
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
6447530 |
ccctgcatataataatgcattgtccctgccaactgagttatgctcacggg |
6447579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 4674865 - 4674917
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | || ||||||||||||||||||| |||| |
|
|
| T |
4674865 |
ccctgcatataataatgcattgtccctgtcaactgagctatgctcacgaggac |
4674917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 7147069 - 7147120
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||||||||||| || ||| ||||||||||||||||||||||||| |
|
|
| T |
7147069 |
ccctgcatataataatgcat-gtccttaccaactgagctatgctcacggggac |
7147120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 9963461 - 9963409
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| | ||||||||||||||| ||||||||||| |
|
|
| T |
9963461 |
ccctgcatataacaatgcattgtccctgccaactgagctatactcacggggac |
9963409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 24 - 67
Target Start/End: Original strand, 42618469 - 42618512
Alignment:
| Q |
24 |
atataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||||||||||||||| | ||||||||||| |||||||||||| |
|
|
| T |
42618469 |
atataataatgcattgtccctgccaactgaggtatgctcacggg |
42618512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 71
Target Start/End: Complemental strand, 30119996 - 30119951
Alignment:
| Q |
25 |
tataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||||||||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
30119996 |
tataataatgcat-gtccttgtcaactgagctatgctcacggggaca |
30119951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 843418 - 843466
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | ||||||||| |||||||||||| |
|
|
| T |
843418 |
ccctacatataataatgcattg-tcataccaactgagatatgctcacggg |
843466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 9176836 - 9176884
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
9176836 |
ccctgcatataataatgcattgtcctt-ccaactgagttatgctcacggg |
9176884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 71
Target Start/End: Complemental strand, 16844137 - 16844108
Alignment:
| Q |
42 |
cttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16844137 |
cttgccaactgagctatgctcacggggaca |
16844108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 32 - 69
Target Start/End: Original strand, 17242709 - 17242746
Alignment:
| Q |
32 |
atgcattgttcttgccaactgagctatgctcacgggga |
69 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
17242709 |
atgcattatccttgccaactgagctatgctcacgggga |
17242746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 18872566 - 18872518
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
18872566 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
18872518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 37417179 - 37417228
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||| ||||| | |||||||||||||| ||||||||| |
|
|
| T |
37417179 |
ccctgcatataataatgtattgtccctgccaactgagctaagctcacggg |
37417228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 4009907 - 4009859
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||||||| ||||||| ||||| |
|
|
| T |
4009907 |
catatattaatgcattgtccttaccaactgagctaagctcacgaggaca |
4009859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 67
Target Start/End: Original strand, 4666501 - 4666544
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||||||||||||||| |
|
|
| T |
4666501 |
catataataatgcattgttc-taccaattgagctatgctcacggg |
4666544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 4794014 - 4793962
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||| |||||||||||| | | |||| |||||||||||||||||||| |
|
|
| T |
4794014 |
ccctgcatattataatgcattgtccctaccaattgagctatgctcacggggac |
4793962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 10106675 - 10106624
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||||||||| || || | ||||||||||||||||||| ||||||| |
|
|
| T |
10106675 |
ccctacatataataatggat-gtccctgccaactgagctatgctcgcggggac |
10106624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 71
Target Start/End: Original strand, 40250232 - 40250279
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||| ||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
40250232 |
catataacaatgcat-gttactgccaactgagctatgctcacggggaca |
40250279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 4855 - 4907
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
4855 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggac |
4907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 25071 - 25019
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
25071 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggac |
25019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 451425 - 451477
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||||||||| |||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
451425 |
ccctacatataacaatgcattgtccttgctaactgagctatgctcacggggac |
451477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 440444 - 440405
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctat |
58 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
440444 |
ccctacatataataatgca-tgttcctgccaactgagctat |
440405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 24)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 2800064 - 2800012
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
2800064 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggac |
2800012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 10292397 - 10292345
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
10292397 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggac |
10292345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 21133574 - 21133621
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
21133574 |
catataataatgcattgttcctgccaactgagttatgctcacggggac |
21133621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 2696578 - 2696525
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
2696578 |
ccctgcatataataatgcattgtccctgccaactgagttatgctcacggggaca |
2696525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 38790623 - 38790676
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||| |||||||||||||||| |
|
|
| T |
38790623 |
ccctgcatataataatgcattgtccctgccaactgagttatgctcacggggaca |
38790676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 31129345 - 31129297
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||||||||||||||||| | |||||||||||||||| ||||||||||| |
|
|
| T |
31129345 |
catataataatgcattgtccctgccaactgagctatgatcacggggaca |
31129297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 1588812 - 1588759
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||| |||||||||||| |||||| |
|
|
| T |
1588812 |
ccctgcatataataatgcattgtccctgccaactaagctatgctcacagggaca |
1588759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 14012657 - 14012604
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| |||||||||| | |||||||||| ||||||||||||||||| |
|
|
| T |
14012657 |
ccctgcatataacaatgcattgtccctgccaactgaactatgctcacggggaca |
14012604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 29108706 - 29108659
Alignment:
| Q |
19 |
cctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
29108706 |
cctacatataataatgcattgtccta-ccaactgagctatgctcacggg |
29108659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 32 - 71
Target Start/End: Complemental strand, 32878693 - 32878654
Alignment:
| Q |
32 |
atgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
32878693 |
atgcattgttcttaccaactgagctaagctcacggggaca |
32878654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 36815519 - 36815566
Alignment:
| Q |
24 |
atataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
36815519 |
atataataatgcattgtctctgtcaactgagctatgctcacggggaca |
36815566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 67
Target Start/End: Original strand, 41225718 - 41225763
Alignment:
| Q |
21 |
tacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
41225718 |
tacatataataatgcattgtccta-ccaactgagctatgctcacggg |
41225763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 7649574 - 7649526
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | |||| ||||||||||||||||| |
|
|
| T |
7649574 |
ccctacatataataatgcattg-tcctaccaagtgagctatgctcacggg |
7649526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 9525002 - 9524954
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
9525002 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
9524954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 22 - 67
Target Start/End: Original strand, 14010826 - 14010870
Alignment:
| Q |
22 |
acatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
14010826 |
acatataataatgcactgt-cttaccaactgagctatgctcacggg |
14010870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 15042415 - 15042463
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
15042415 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
15042463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 23857374 - 23857422
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
23857374 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
23857422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 24608533 - 24608581
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
24608533 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
24608581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 28465663 - 28465615
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
28465663 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
28465615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 39484420 - 39484468
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
39484420 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
39484468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 43468755 - 43468803
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
43468755 |
ccctacatataacaatgcattgtccta-ccaactgagctatgctcacggg |
43468803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 22426446 - 22426398
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
||||||||||||||||||||||| | || ||| |||| ||||||||||| |
|
|
| T |
22426446 |
ccctacatataataatgcattgtccctgtcaattgagttatgctcacgg |
22426398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 58
Target Start/End: Original strand, 35301213 - 35301253
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctat |
58 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
35301213 |
ccctgcatataataatgcattgtccctgccaactgagctat |
35301253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 26 - 70
Target Start/End: Complemental strand, 37128774 - 37128730
Alignment:
| Q |
26 |
ataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||||||| | |||||| |||||||||||||| ||||| |
|
|
| T |
37128774 |
ataataatgcattgtccctgccaattgagctatgctcacagggac |
37128730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 28)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 41139132 - 41139080
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
41139132 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacggggac |
41139080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 14818415 - 14818468
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
14818415 |
ccctgcatataataatgcactgtccctgccaactgagctatgctcacggggaca |
14818468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 15265413 - 15265466
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
15265413 |
ccctgcatataataatgcactgtccctgccaactgagctatgctcacggggaca |
15265466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 16814742 - 16814690
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||| |||||| |
|
|
| T |
16814742 |
ccctacatataataatgcat-gttcttgccaactgagctatgttcacagggaca |
16814690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 41417325 - 41417378
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||| ||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
41417325 |
ccctgcatataatgatgcactgttcctgccaactgagctatgctcacggggaca |
41417378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 21285403 - 21285455
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
21285403 |
ccctgcatataacaatgcattgtccctgccaactgagctatgctcacggggac |
21285455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 31475890 - 31475939
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||| ||| | |||||||||||||||||||||||| |
|
|
| T |
31475890 |
ccctgcatataataatgcaatgtccctgccaactgagctatgctcacggg |
31475939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 23 - 60
Target Start/End: Original strand, 34960975 - 34961012
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgc |
60 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34960975 |
catataataatgcattgttcatgccaactgagctatgc |
34961012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 45417518 - 45417470
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| ||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
45417518 |
ccctgcatataataatacattgttct-gccaactgagctatgctcacggg |
45417470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 15912820 - 15912768
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||||| |||||| |||||||| ||||||||||| |
|
|
| T |
15912820 |
ccctgcatataacaatgcattgttcctgccaattgagctattctcacggggac |
15912768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 46915008 - 46914960
Alignment:
| Q |
19 |
cctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||||| |||||||||||| |
|
|
| T |
46915008 |
cctatatataataatgtattgttcgtgccaactgagttatgctcacggg |
46914960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 23 - 70
Target Start/End: Complemental strand, 4169116 - 4169069
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||| ||| |||||| | ||||||||||||||||||||||||||| |
|
|
| T |
4169116 |
catataacaatacattgtccctgccaactgagctatgctcacggggac |
4169069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 24 - 71
Target Start/End: Complemental strand, 19126776 - 19126729
Alignment:
| Q |
24 |
atataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||| ||||||||| |
|
|
| T |
19126776 |
atataataatgcattgttcctaccaactgagctatgccgacggggaca |
19126729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 24 - 71
Target Start/End: Complemental strand, 48175006 - 48174960
Alignment:
| Q |
24 |
atataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
48175006 |
atataataatgcat-gtccttgccaactgagctatactcacggggaca |
48174960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 67
Target Start/End: Complemental strand, 30566545 - 30566499
Alignment:
| Q |
21 |
tacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||||||| |||||||||| | ||||||| |||||||||||||||| |
|
|
| T |
30566545 |
tacatataacaatgcattgtccctgccaaccgagctatgctcacggg |
30566499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 21 - 67
Target Start/End: Original strand, 35919724 - 35919769
Alignment:
| Q |
21 |
tacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
35919724 |
tacatataataatgcattgt-cttaacaactgagctatgctcacggg |
35919769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 23470550 - 23470594
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctca |
63 |
Q |
| |
|
|||||||||||||||| ||| |||| |||||||||||||||||||| |
|
|
| T |
23470550 |
ccctacatataataatacat-gttcatgccaactgagctatgctca |
23470594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 24304333 - 24304386
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||||| || ||| | ||||||||| ||||||||| |
|
|
| T |
24304333 |
ccctgcatataataatgcattgttcctgtcaattaagctatgcttacggggaca |
24304386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 23 - 64
Target Start/End: Original strand, 27674861 - 27674902
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcac |
64 |
Q |
| |
|
||||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27674861 |
catataacaatgcattgtccttgcgaactgagctatgctcac |
27674902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 29658322 - 29658375
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| |||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
29658322 |
ccctgcatataacaatgcattgtcgctgccaattgagctatgctcacggggaca |
29658375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 29710150 - 29710198
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | ||||||||||||| |||||||| |
|
|
| T |
29710150 |
ccctacatataataatgcattg-tcctaccaactgagctatactcacggg |
29710198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 35195888 - 35195836
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||||||||||| || | |||||||||||||||||| ||||||||| |
|
|
| T |
35195888 |
ccctgcatataataatgcat-gtccctgccaactgagctatgcttacggggaca |
35195836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 49012443 - 49012395
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
49012443 |
cccttcatataataatgcattgtccta-ccaactgagctatgctcacggg |
49012395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 71
Target Start/End: Original strand, 7392361 - 7392408
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||| ||||||| |||| |||||| ||||||||||||||||||||| |
|
|
| T |
7392361 |
catataacaatgcat-gttcctgccaattgagctatgctcacggggaca |
7392408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 20527479 - 20527531
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| | ||||||||||||||| ||||| ||||| |
|
|
| T |
20527479 |
ccctgcatataacaatgcattgtccctgccaactgagctatactcacagggac |
20527531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 37917437 - 37917386
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||| |||||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
37917437 |
ccctgcatataattatgcat-gttcctaccaactgagctatgctcacggggac |
37917386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 38451908 - 38451856
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| | || |||||||||||||||||| ||||| |
|
|
| T |
38451908 |
ccctgcatataacaatgcattgtccctgtcaactgagctatgctcacagggac |
38451856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 67
Target Start/End: Original strand, 43970908 - 43970951
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
43970908 |
catataataatgcattgttc-taccaactgagttatgctcacggg |
43970951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000002; HSPs: 29)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 2114485 - 2114533
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
2114485 |
ccctacatataataatgcattgttc-taccaactgagctatgctcacggg |
2114533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 21970489 - 21970542
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | || ||||||||||||||||||||||||| |
|
|
| T |
21970489 |
ccctgcatataataatgcattgtccctgtcaactgagctatgctcacggggaca |
21970542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 29035021 - 29034968
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| |||||||||||||||||| | |||||| ||||||||||||||||||||| |
|
|
| T |
29035021 |
ccctgcatataataatgcattgtccctgccaagtgagctatgctcacggggaca |
29034968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 23 - 72
Target Start/End: Complemental strand, 34034391 - 34034342
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
|||||||||||| ||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
34034391 |
catataataatgtattgtccctgccaactgagctatgctcacggggacag |
34034342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 2304335 - 2304283
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||||||||||||| |||||| | |||||||||||||| |||||||||||| |
|
|
| T |
2304335 |
ccctacatataataatacattgtccctgccaactgagctaagctcacggggac |
2304283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 2935857 - 2935813
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2935857 |
catataacaatgcattgttcctgccaactgagctatgctcacggg |
2935813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 23 - 70
Target Start/End: Complemental strand, 43870993 - 43870946
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
43870993 |
catataataatgcattgtccttgccaaccgagctatgctcatggggac |
43870946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 71
Target Start/End: Complemental strand, 11133121 - 11133068
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| |||||||||| | | |||||||||||||||||||||||||| |
|
|
| T |
11133121 |
ccctgcatataacaatgcattgtccctaccaactgagctatgctcacggggaca |
11133068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 20122525 - 20122573
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
20122525 |
ccctacatataataatgcattg-tcctaccaactgagctatgctcacggg |
20122573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 29664648 - 29664596
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| | |||||| |||||||||||||||||||| |
|
|
| T |
29664648 |
ccctgcatataacaatgcattgtccctgccaattgagctatgctcacggggac |
29664596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 23 - 70
Target Start/End: Original strand, 35456841 - 35456888
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||| ||||||| |||| |
|
|
| T |
35456841 |
catatattaatgcattgttcttaccaactgagctaagctcacgaggac |
35456888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 42 - 72
Target Start/End: Complemental strand, 5772882 - 5772852
Alignment:
| Q |
42 |
cttgccaactgagctatgctcacggggacag |
72 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5772882 |
cttgccaactgagctatgctcacggggacag |
5772852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 25 - 67
Target Start/End: Complemental strand, 32988388 - 32988347
Alignment:
| Q |
25 |
tataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
32988388 |
tataataatgcattgt-cttaccaactgagctatgctcacggg |
32988347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 33 - 67
Target Start/End: Original strand, 33045040 - 33045074
Alignment:
| Q |
33 |
tgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
33045040 |
tgcattgttcttaccaactgagctatgctcacggg |
33045074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 580833 - 580881
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
580833 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
580881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Complemental strand, 3179369 - 3179321
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||||| | ||||||||| |||||||||||| |
|
|
| T |
3179369 |
ccctgcatataataatgcattgttc-taccaactgagttatgctcacggg |
3179321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 8234842 - 8234890
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||||||||||||||| ||||| || |||||||||||||||||||||| |
|
|
| T |
8234842 |
ccctacatataataatgtattgtccta-ccaactgagctatgctcacggg |
8234890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Complemental strand, 17239946 - 17239902
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctca |
63 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
17239946 |
ccctgcatataataatgcattgttc-taccaactgagctatgctca |
17239902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 18364425 - 18364473
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||||| | |||||| ||||||||||||||| |
|
|
| T |
18364425 |
ccctgcatataataatgcattgttc-taccaactcagctatgctcacggg |
18364473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 20 - 61
Target Start/End: Original strand, 19072446 - 19072487
Alignment:
| Q |
20 |
ctacatataataatgcattgttcttgccaactgagctatgct |
61 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| |||||| |
|
|
| T |
19072446 |
ctacatataataatgcattattcttaccaactgagttatgct |
19072487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 42 - 71
Target Start/End: Complemental strand, 22355105 - 22355076
Alignment:
| Q |
42 |
cttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
22355105 |
cttgccaactgagctatgctcacggggaca |
22355076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 30474245 - 30474293
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
30474245 |
ccctgcatataataatgcattgtccta-ccaactgagctatgctcacggg |
30474293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 32527127 - 32527168
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatg |
59 |
Q |
| |
|
|||| |||||||||||||||||| | |||||||||||||||| |
|
|
| T |
32527127 |
ccctgcatataataatgcattgtccctgccaactgagctatg |
32527168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 36520830 - 36520878
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
|||||||||||||||||||||| || | |||||||||||| ||||||||| |
|
|
| T |
36520830 |
ccctacatataataatgcattg-tcctaccaactgagctacgctcacggg |
36520878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 63
Target Start/End: Original strand, 40044129 - 40044174
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctca |
63 |
Q |
| |
|
|||| ||||||||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
40044129 |
ccctgcatataataatacattgtccttaccaactgagctatgctca |
40044174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 71
Target Start/End: Complemental strand, 7052814 - 7052766
Alignment:
| Q |
23 |
catataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||| || ||||||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
7052814 |
catattattatgcattgtccttaccaactgagctaagctcacggggaca |
7052766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 19 - 67
Target Start/End: Original strand, 15392262 - 15392309
Alignment:
| Q |
19 |
cctacatataataatgcattgttcttgccaactgagctatgctcacggg |
67 |
Q |
| |
|
||||||||||||||||||||| || | ||||||||| |||||||||||| |
|
|
| T |
15392262 |
cctacatataataatgcattg-tcctaccaactgagttatgctcacggg |
15392309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 36277752 - 36277803
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
36277752 |
ccctacatataacaatgcat-gtcactgccaactgagctatgctcacggggac |
36277803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 44187749 - 44187701
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacgg |
66 |
Q |
| |
|
|||| |||||||||||||||| | | |||||||||| |||||||||||| |
|
|
| T |
44187749 |
ccctgcatataataatgcattatccctgccaactgaactatgctcacgg |
44187701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 37; Significance: 0.000000000009; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 12610 - 12558
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
12610 |
ccctgcatataataatgcattgtccctgccaactgagctatgctcacagggac |
12558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold2098 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold2098
Description:
Target: scaffold2098; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 663 - 715
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||||||||||| ||||| ||||| |
|
|
| T |
663 |
ccctacatataacaatgcattgtccctgccaactgagctatactcacagggac |
715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 7121 - 7069
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| |||||||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
7121 |
ccctgcatataataatgcattgtccctaacaactgagctatgctcacggggac |
7069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 21895 - 21843
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
21895 |
ccctgcatataataatacattgtttctgccaactgagctatactcacggggac |
21843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 32 - 71
Target Start/End: Complemental strand, 204622 - 204583
Alignment:
| Q |
32 |
atgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
204622 |
atgcattgttcatgccaactgagctatgctcacgaggaca |
204583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 71
Target Start/End: Original strand, 34083 - 34135
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggaca |
71 |
Q |
| |
|
|||| ||||||| ||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
34083 |
ccctgcatataacaatgcat-gtccctgccaactgagctatgctcacggggaca |
34135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 18 - 59
Target Start/End: Original strand, 108411 - 108452
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatg |
59 |
Q |
| |
|
|||| |||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
108411 |
ccctgcatataataatgcattgttcctgccaattgagctatg |
108452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Complemental strand, 1084 - 1033
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
||||||||||||| |||||| || | | ||||||||||||||||||||||||| |
|
|
| T |
1084 |
ccctacatataattatgcat-gtccctaccaactgagctatgctcacggggac |
1033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0112 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0112
Description:
Target: scaffold0112; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 18 - 70
Target Start/End: Original strand, 17981 - 18033
Alignment:
| Q |
18 |
ccctacatataataatgcattgttcttgccaactgagctatgctcacggggac |
70 |
Q |
| |
|
|||| ||||||| |||||||||| | | |||| |||||||||||||||||||| |
|
|
| T |
17981 |
ccctgcatataacaatgcattgtccctaccaattgagctatgctcacggggac |
18033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University