View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9741_high_10 (Length: 240)
Name: NF9741_high_10
Description: NF9741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9741_high_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 9500794 - 9501007
Alignment:
| Q |
1 |
gaacaatttcctgctgctactcctcttgctttggtgctaaaacagtttttagcagaccggagccttgaccagtcctactctggtggattaagttcctact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500794 |
gaacaatttcctgctgctactcctcttgctttggtgctaaaacagtttttagcagaccggagccttgaccagtcctactctggtggattaagttcctact |
9500893 |
T |
 |
| Q |
101 |
gtttggtatgcannnnnnnnnncgtacacaaataattttcgtttcttaatgaattatccagatgtcctttgtgttggagtaacaaattgctgcagcttcc |
200 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9500894 |
gtttggtatgca--ttttttttcgtacac--ataattttcgtttcttaatgaattatccagatgtcctttgtgttggagtaacaaattgctgcagcttcc |
9500989 |
T |
 |
| Q |
201 |
cagatagtctatactata |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
9500990 |
cagatagtctatactata |
9501007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University