View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9741_high_7 (Length: 277)
Name: NF9741_high_7
Description: NF9741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9741_high_7 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 24 - 269
Target Start/End: Complemental strand, 2768428 - 2768181
Alignment:
| Q |
24 |
ggaacctaagcctcctcgtacgacacataaattacttcaggta-tctcattttaacacttggaagtgctaattgatgaggaaaataaaaactgttatctt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2768428 |
ggaacctaagcctcctcgtacgacacataaattacttcaggtaatctcattttaacacttggaagtgctaattgatgaggaaaataaaaactgttatctt |
2768329 |
T |
 |
| Q |
123 |
cgttaactgatgttaacgtctttcttcagtttatcgtatgctttttaacacccgttgcatcaaagcattataacctataa-ggtataccatcctacttta |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
2768328 |
cgttaactgatgttaacgtctttcttcagtttatcgtatgctttttaacacccgttgcatcaaagcattataacctataagggtataccatcctacttta |
2768229 |
T |
 |
| Q |
222 |
acatatgtttggatgcgtggctgtaactttttcttgcatccctatgct |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2768228 |
gcatatgtttggatgcgtggctgtaactttttcttgcatccctatgct |
2768181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University