View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9741_high_8 (Length: 277)
Name: NF9741_high_8
Description: NF9741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9741_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 21 - 267
Target Start/End: Complemental strand, 36812773 - 36812527
Alignment:
| Q |
21 |
gaactaaccggtttcaacgaggctgataaatacatccatcaaagaaaagctctatatgttaaggtgtttgtacataacttcaacgagtggataacttcaa |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36812773 |
gaactaaccggtttcaacgaggctgataaatacatccatcaaagaaaagctctatatgttaaggtgtttgtacataacttcaacgagtggataacttcaa |
36812674 |
T |
 |
| Q |
121 |
atgcttttgaagcttcattttgcaagtatttagttccaacagttgtgacttcatcatctcaacatcttttctcattacttttatctcctgattcatctgt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36812673 |
atgcttttgaagcttcattttgcaagtatttagttccagcagttgtgacttcatcatctcaacatcttttctcattacttttatctcctgattcatctgt |
36812574 |
T |
 |
| Q |
221 |
ctcttttcaaaatctttgcttaccctgatgcttgtcttactcctatg |
267 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36812573 |
ctcttttcaaaatctttgcttatcctgatgcttgtcttactcctatg |
36812527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University