View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9741_low_7 (Length: 382)
Name: NF9741_low_7
Description: NF9741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9741_low_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 23 - 363
Target Start/End: Original strand, 32358609 - 32358952
Alignment:
| Q |
23 |
cgcatcaaaaactgatgagagggtggaccgtgaaaccaccactcgagatcaggagcgaggattcgaaccacggtgtcagagtctcgagagtttagggagt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32358609 |
cgcatcaaaaactgatgagagggtggaccgtgaaaccaccactcgagatcaggggcgaggattcgaaccacggtgtcagagtctcgagagtttagggagt |
32358708 |
T |
 |
| Q |
123 |
catatagtgtgagaaccagcttttgattgctggaatcagtgtcttcggtattaacctgagagttagccagatcgag---nnnnnnnngtggttttctaga |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
32358709 |
catatagtgtgagaaccagcttttgattgctggaatcagtgtcttcggtattaacctgagagttagccagatcgagaaaaaaaaaaagtggttttctaga |
32358808 |
T |
 |
| Q |
220 |
aatttctgagtttgggattttggattaggtaatggaatgttgtaaatgatactttgtggttgaaatggtgtgaggtttttatagagaggtgtttgtgatt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32358809 |
aatttctgagtttgggattttggattaggtaatggaatgttgtaaatgatactttgtggttgaaatggtgtgaggtttttatagagaggtgtttgtgatt |
32358908 |
T |
 |
| Q |
320 |
gtgtgtgggtgggtttaggtggaactttgttgtgtgatgacgtg |
363 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32358909 |
gtgtgtgggtgggtttaggtggaactttgttgtgtgatgacgtg |
32358952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University