View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9742_low_5 (Length: 248)

Name: NF9742_low_5
Description: NF9742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9742_low_5
NF9742_low_5
[»] chr7 (1 HSPs)
chr7 (24-233)||(5214372-5214581)


Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 24 - 233
Target Start/End: Original strand, 5214372 - 5214581
Alignment:
24 ggtacttggcatgttggagctagatgttgattggcattttctcatcaatgaggtgtcaaaatctatgattggattttacctaaccaataatgtcattttt 123  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5214372 ggtacttggcatgttggagctagatgttgattggcattttcttatcaatgaggtgtcaaaatctatgattggattttacctaaccaataatgtcattttt 5214471  T
124 gtctaacttcaaattgataattagccaaaaaattattcacatggacatgtttcattgctagcatcacaggcgataaatatttgcttccccgacctcggta 223  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||    
5214472 gtctagcttcaaattgataattagccaaaaaattattcacatggacatgtttcattactagcatcacaggcgataattatttgcttccccgaccttggta 5214571  T
224 gcgtcctttg 233  Q
    ||||||||||    
5214572 gcgtcctttg 5214581  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University