View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9742_low_5 (Length: 248)
Name: NF9742_low_5
Description: NF9742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9742_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 24 - 233
Target Start/End: Original strand, 5214372 - 5214581
Alignment:
| Q |
24 |
ggtacttggcatgttggagctagatgttgattggcattttctcatcaatgaggtgtcaaaatctatgattggattttacctaaccaataatgtcattttt |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5214372 |
ggtacttggcatgttggagctagatgttgattggcattttcttatcaatgaggtgtcaaaatctatgattggattttacctaaccaataatgtcattttt |
5214471 |
T |
|
| Q |
124 |
gtctaacttcaaattgataattagccaaaaaattattcacatggacatgtttcattgctagcatcacaggcgataaatatttgcttccccgacctcggta |
223 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
5214472 |
gtctagcttcaaattgataattagccaaaaaattattcacatggacatgtttcattactagcatcacaggcgataattatttgcttccccgaccttggta |
5214571 |
T |
|
| Q |
224 |
gcgtcctttg |
233 |
Q |
| |
|
|||||||||| |
|
|
| T |
5214572 |
gcgtcctttg |
5214581 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University