View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9742_low_6 (Length: 247)
Name: NF9742_low_6
Description: NF9742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9742_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 10 - 246
Target Start/End: Complemental strand, 1946815 - 1946579
Alignment:
| Q |
10 |
agatggacatcaagtttgtaacttttctgattttccttgattgtgggaaccattccctccctcttatggttgatgaaaaagtgaaagcttgttttctttt |
109 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1946815 |
agatggacagcaagtttgtaacttttctgattttccttgattgtgggaaccattccctccctcttatggttggtgaaaaagtgaaagcttgttttctttt |
1946716 |
T |
 |
| Q |
110 |
aacttttcatttgattaatcatgttttaaatatagaaacttacaagtaaaataatctctacaataattcttaggtagatcatgtgtaaccttgattatta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1946715 |
aacttttcatttgattaatcatgttttaaatatagatacttacaagtaaaataatctctacaataattcttaggtagatcatgtgtaaccttgattatta |
1946616 |
T |
 |
| Q |
210 |
gggttccttttcactagaaattagctagaggataaaa |
246 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1946615 |
gggttccttttcactagaaattagctaaaggataaaa |
1946579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 12 - 60
Target Start/End: Complemental strand, 28957595 - 28957547
Alignment:
| Q |
12 |
atggacatcaagtttgtaacttttctgattttccttgattgtgggaacc |
60 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28957595 |
atggacagcaagtttgtaacttttctgattttccttgattgtgggaacc |
28957547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University