View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9742_low_9 (Length: 238)
Name: NF9742_low_9
Description: NF9742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9742_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 77 - 223
Target Start/End: Original strand, 5567224 - 5567370
Alignment:
| Q |
77 |
gcgcgcgcacgtacatgtagataaatagataactcgtcaattagaacttgagcatactcctcagggttataggtgccacttgtgttgtagagttttggtt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5567224 |
gcgcgcgcacgtacatgtagataaatagataactcgtcaattagaacttgagcatactcctcagggttataggtgccacttgtgttgtagagttctggtt |
5567323 |
T |
 |
| Q |
177 |
ggaaataatttaacgagtaatcgttggtgcctatataaacataatac |
223 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5567324 |
ggaaataatttaacgagtaattgttggtgcctatataaacataatac |
5567370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 2 - 56
Target Start/End: Original strand, 5567103 - 5567157
Alignment:
| Q |
2 |
accgtaaaacaaatagaaattaaaaacttctttttaacaagaatgatatatatat |
56 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5567103 |
accgtaaaccaaatagaaattaaaaacttctttttaacaagaatgatatatatat |
5567157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University