View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9743_low_14 (Length: 244)
Name: NF9743_low_14
Description: NF9743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9743_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 34457018 - 34457110
Alignment:
| Q |
1 |
ccattatgctaaccataatcaaaaccctagttgtcgatgccaatttgttagcgcatcaatcactatacttgctctaaatgaaagtgcctcaac |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34457018 |
ccattatgctaaccataatcaaaaccctagttgtcgatgccaatttgttagtgcatcaatcactatacttgctctaaatgaaagtgcctcaac |
34457110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University