View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9744_low_13 (Length: 245)
Name: NF9744_low_13
Description: NF9744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9744_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 21 - 232
Target Start/End: Original strand, 9496725 - 9496936
Alignment:
| Q |
21 |
gtgtggccttcttggagaggtaaaaacattgcagtacagcctctgatccaacctttacctgctgccttgctgcaggaccgcctgattgcaatgtcacaga |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496725 |
gtgtggccttcttggagaggtaaaaacattgcagtacagcctctgattcaacctttacctgctgccttgctgcaggaccgcctgattgcaatgtcacaga |
9496824 |
T |
 |
| Q |
121 |
tagcacgtgaccaggaacatgtaagaaagattgttgcttaagtcctactagatacatatatgttggtgttcattgtgggtgtttaattatacagccggat |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9496825 |
tagcacgtgaccaggaacatgtaagaaagattgttgcttaagtcctactagatacatatatgttggtgttcattgtgggtgtttaattatacagccggat |
9496924 |
T |
 |
| Q |
221 |
gttaccttacct |
232 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9496925 |
gttaccttacct |
9496936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University