View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9744_low_14 (Length: 237)
Name: NF9744_low_14
Description: NF9744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9744_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 2409039 - 2409249
Alignment:
| Q |
11 |
tggagtataccatcaagtttataatcccatatgaacagtttgctacctgtcactgcccaaacacatatacatcacaaattgaacatagataaagagattc |
110 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409039 |
tggagtataccatcaagttcatcatcccatatgaacactttgctacctgtcactgcccaaacacatatacatcacaaattgaacatagataaagagattc |
2409138 |
T |
 |
| Q |
111 |
aaagtnnnnnnnntaatgaaattagaagattaggaggaaagattttcgaacgaactcattgtctagtttggacatttccaatattttcctgttagggttt |
210 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2409139 |
aaagt--aaaaaataatgaaattagaagattgggaggaaagattatcgaacgaactcattgtctagtttggacatttccaatattttcctgttagggttt |
2409236 |
T |
 |
| Q |
211 |
tcattgaaattgg |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
2409237 |
tcattgaaattgg |
2409249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University