View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9745_low_5 (Length: 266)
Name: NF9745_low_5
Description: NF9745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9745_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 7830014 - 7830253
Alignment:
| Q |
11 |
caaaggtatgtggcaatcattatgcacttgaggctaatgagaagagacgtgtttgagtttaggtgattgtnnnnnnntagagatatcttagtatcattac |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7830014 |
caaaggtatgtggcaatcattatgcacttgaggctaatgagaagagacgtgtttgagtttaggtgattgtaaaaaaatagagatatcttagtatcattag |
7830113 |
T |
 |
| Q |
111 |
aatatcaagctttccactctggattatgcctaataaggatatctattattgcattctagttggtgtaagaaatttgttctgattctataataagaagaac |
210 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7830114 |
aatatcaagctttccactcaggattatggctaataaggatatctattattgcattctagttggtgtaagaaatttgttctgattctataataagaagaac |
7830213 |
T |
 |
| Q |
211 |
aaatacagacgtatatcttcttttgtaagcactttattaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7830214 |
aaatacagacgtatatcttcttttgtaagcactttattaa |
7830253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University