View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9746_high_10 (Length: 339)
Name: NF9746_high_10
Description: NF9746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9746_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 240 - 334
Target Start/End: Complemental strand, 18955045 - 18954951
Alignment:
| Q |
240 |
tctataaataaatctggtgctctcattctcctnnnnnnncttggtattctcgttaaaatcttcgttaccaattttccaattatctctgcttctcc |
334 |
Q |
| |
|
|||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18955045 |
tctataaataaatctgctgttctcattctcctaaaaaaacttggtattctcgttaaaatcttcgttaccaattttccaattatgtctgcttctcc |
18954951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University