View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9746_high_13 (Length: 283)
Name: NF9746_high_13
Description: NF9746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9746_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 8e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 8e-98
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 24141194 - 24140934
Alignment:
| Q |
1 |
tctatcgccagtggcggagccacatataaccttatgtaggcacaagccctgcacaaacttttgagannnnnnnncttcttattatatgttacactttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
24141194 |
tctatcgccagtggcggagccacatataaccttatgtaggcacatgcc-tgcacaaacttttgaattttttcttcttcttatcatatgttacactttgat |
24141096 |
T |
 |
| Q |
101 |
taagctcacaatgatcattaaccattaaaaattgttaccggtataaaagctttactccacacactcacgcattaacatatggcaataagcaatggaaagt |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24141095 |
taagctcacattgatcattaaccattaaaaattgttaccagtataaaagcttcactccacacactcacgcattaacatatggcaataagcaatggaaagt |
24140996 |
T |
 |
| Q |
201 |
gaaatgtaatataccctcttttaccttttaagtgttgcattttgattatttgaactattcatat |
264 |
Q |
| |
|
| ||||||||| ||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24140995 |
gcaatgtaatacacc--cttttaccttttaagtgtcgcattttgattatttgaactattcatat |
24140934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 83 - 138
Target Start/End: Original strand, 1381925 - 1381980
Alignment:
| Q |
83 |
tatatgttacactttgattaagctcacaatgatcattaaccattaaaaattgttac |
138 |
Q |
| |
|
||||||||||| |||| ||||||||| | ||||||| |||||||| |||||||||| |
|
|
| T |
1381925 |
tatatgttacattttgtttaagctcatactgatcatcaaccattataaattgttac |
1381980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University