View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9746_high_15 (Length: 262)
Name: NF9746_high_15
Description: NF9746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9746_high_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 43091238 - 43091052
Alignment:
| Q |
1 |
taggtagtagtagggtgttggagatggaaaaaggaacaatgttgattcatctaaaaagctatcttttattggttcagctttaatgcataaaagtaacaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091238 |
taggtagtagtagggtgttggagatggaaaaaggaacaatgttgattcatctaaaaagctatcttttattggttcagctttaatgcataaaagtaacaga |
43091139 |
T |
 |
| Q |
101 |
accatattcagaagaaagaaagatgaattattcgatttctttttacgagtcacacaatcacaaactgtttctttgatttagggagtt |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43091138 |
accatattcagaagaaagaaagatgaattattcgatttctttttacgagtcacacaatcacaaactttttctttgatttagggagtt |
43091052 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 188 - 240
Target Start/End: Complemental strand, 43090992 - 43090940
Alignment:
| Q |
188 |
atacacacacattgaagaaatttagcagaagaagaagttgatatatttgttat |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43090992 |
atacacacacattgaagaaatttagcagaagaagaagttgatatatttgttat |
43090940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University