View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9746_high_17 (Length: 258)
Name: NF9746_high_17
Description: NF9746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9746_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 6e-89; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 20 - 254
Target Start/End: Complemental strand, 34578900 - 34578662
Alignment:
| Q |
20 |
tggtgaacgtgcttagggttatagactagttactattctggtattggaatgatttcagggttttgatttagnnnnnnnn----atcagttatctcttatg |
115 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
34578900 |
tggtgaacgagcttagggttatagactagttactattctggtattggaatgatttcagggttttgatttagttttttttttttatcagttatcttttatg |
34578801 |
T |
|
| Q |
116 |
ctgccttaaccatggtgatcatgtttagggttacggattcttatcagtttttcctttctcttcaaattattccacttaaataattttactatgtttttcc |
215 |
Q |
| |
|
|| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34578800 |
cttccgtaaccatggtgatcatgtttagggttacatattcttatcagtttttcctttctctgcaaattattccacttaaataattttactatgtttttcc |
34578701 |
T |
|
| Q |
216 |
tttctctgcaaattatttacttatttttctctgcttctc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
34578700 |
tttctctgcaaattatttacttatttttctcttcttctc |
34578662 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 20 - 71
Target Start/End: Complemental strand, 34584649 - 34584598
Alignment:
| Q |
20 |
tggtgaacgtgcttagggttatagactagttactattctggtattggaatga |
71 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34584649 |
tggtgaacgagcttagggttatagactagttactattctggtattggaatga |
34584598 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 201 - 254
Target Start/End: Complemental strand, 34584456 - 34584403
Alignment:
| Q |
201 |
ttactatgtttttcctttctctgcaaattatttacttatttttctctgcttctc |
254 |
Q |
| |
|
||||| ||| ||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
34584456 |
ttactgtgtatttcctttctctgcacattatttacttatttttctcttcttctc |
34584403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University