View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9746_high_21 (Length: 245)
Name: NF9746_high_21
Description: NF9746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9746_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 9 - 228
Target Start/End: Complemental strand, 48895839 - 48895620
Alignment:
| Q |
9 |
agcagagagagtgtgagaaactagaatctatctattatctacttctagtatataacttgtagaaactcacatgctaccttttttagttttagcatttgct |
108 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
48895839 |
agcatagagagtgtgagaaactagaatctatctattatctacttctagtatataacttgtagaaactcacatgctaccttttttagttttaccatttgct |
48895740 |
T |
|
| Q |
109 |
taacctaccttattcttttcattgcaaacagaaaaaagagctagacttgttttgttccaaacaccactttcaatgactaaagaagaagactttaacctcc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
48895739 |
taacctaccttattcttttcattgcaaacagaaaaaagagctagacttgttttgttccaaacaccactttcaatgactaaagaagaagactttaagctcc |
48895640 |
T |
|
| Q |
209 |
ttaaaatccaggtacttctt |
228 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
48895639 |
ttaaaatccaggtacttctt |
48895620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University