View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9746_low_13 (Length: 339)

Name: NF9746_low_13
Description: NF9746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9746_low_13
NF9746_low_13
[»] chr8 (1 HSPs)
chr8 (240-334)||(18954951-18955045)


Alignment Details
Target: chr8 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 240 - 334
Target Start/End: Complemental strand, 18955045 - 18954951
Alignment:
240 tctataaataaatctggtgctctcattctcctnnnnnnncttggtattctcgttaaaatcttcgttaccaattttccaattatctctgcttctcc 334  Q
    |||||||||||||||| || ||||||||||||       |||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
18955045 tctataaataaatctgctgttctcattctcctaaaaaaacttggtattctcgttaaaatcttcgttaccaattttccaattatgtctgcttctcc 18954951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University