View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9746_low_15 (Length: 295)
Name: NF9746_low_15
Description: NF9746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9746_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 8 - 251
Target Start/End: Original strand, 31737989 - 31738234
Alignment:
| Q |
8 |
ttggtggtgctgtggctgttggtgttgctgggggtgctgctgcttatgctttgaatgctactgcaccgcaagttgcagcggttaatttgcggaattatgt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31737989 |
ttggtggtgctgtggctgttggtgttgctgggggtgctgctgcttatgctttgaatgctactgcaccgcaagttgcagcggttaatttgcggaattatgt |
31738088 |
T |
 |
| Q |
108 |
tgctggatttgatgatgcttccaagttgaagaaggaagatattgaagttattgctaataagttagtttcaattgcataatcaaattttgtttt-atttat |
206 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
31738089 |
tgctgggtttgatgatgcttccaagttgaagaaggaagatattgaagttattgctaataagttagtttcaattgcataatcaaattttgttttaattttt |
31738188 |
T |
 |
| Q |
207 |
aagattatta-ttttaagttagaaaaaaggttaattaattgatatt |
251 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
31738189 |
aagattattacttttaagttagaaaaaaggttaattaattgatatt |
31738234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University