View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9746_low_16 (Length: 291)
Name: NF9746_low_16
Description: NF9746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9746_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 48 - 289
Target Start/End: Original strand, 40240695 - 40240944
Alignment:
| Q |
48 |
tgatcatcgatagagctcatgaagtatttgagccaaattgcttggttgggtcttttacttgtttgaaa-tcaaattgaaaacaacaaaaaatattttaag |
146 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
40240695 |
tgatcattgatagagctcatgaagtatttgagccaaattgcttggttgggtcttttacttgtttgaaaatcaaattgaaaacaacaaaaaatattttaag |
40240794 |
T |
 |
| Q |
147 |
aaatgacaaatatctaacaaaaggttgcttgaaatgtttcctacgaacaaaatcggtttgcacaagcagataca-------tatacagatatcgatctag |
239 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40240795 |
aaatgacaaatatccaacaaaaggttgcttgaaatgtttcctacgaacaaaatcggtttgcacaagcagatacatatacattatacagatatcgatctag |
40240894 |
T |
 |
| Q |
240 |
gtaggtgtttgtattaatccaggatgcaggtttggtacatttttattttt |
289 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40240895 |
gtaggtgtttgtattaatccaggatgcaggtttggtacatttttattttt |
40240944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University