View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9746_low_23 (Length: 257)
Name: NF9746_low_23
Description: NF9746
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9746_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 8167750 - 8167976
Alignment:
| Q |
17 |
agaattgattatggtaactttttggtcctttttcttgcagagatggtgcaaatgtgaaggggtactatgcatggtcattttccgacagctatgaatggga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8167750 |
agaattgattatggtaactttttggtcctttttcttgcagagatggtgcaaatgtgaaggggtactatgcatggtcattttccgacagctatgaatggga |
8167849 |
T |
|
| Q |
117 |
tgcagggtacacagtacgatttggaataatttatgtcgatttcgttaacaatttgaaaagatatcccaagtactctgctttttggctgcaaaagtttctt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
8167850 |
tgcagggtacacagtacgatttggaataatttatgtcgatttcgttaacaatttgaagagatatcccaagtactctgctttttggctgcaaaagttcctt |
8167949 |
T |
|
| Q |
217 |
ctcaagggaaaacactaaatttgatgt |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
8167950 |
ctcaagggaaaacactaaatttgatgt |
8167976 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 44 - 243
Target Start/End: Original strand, 8142955 - 8143154
Alignment:
| Q |
44 |
ctttttcttgcagagatggtgcaaatgtgaaggggtactatgcatggtcattttccgacagctatgaatgggatgcagggtacacagtacgatttggaat |
143 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8142955 |
ctttttcttgtagacatggtgcaaatgtgaaggggtactatgcatggtcattttccgacagctatgaatgggatgcagggtacacagtacgatttggaat |
8143054 |
T |
|
| Q |
144 |
aatttatgtcgatttcgttaacaatttgaaaagatatcccaagtactctgctttttggctgcaaaagtttcttctcaagggaaaacactaaatttgatgt |
243 |
Q |
| |
|
||||||||| |||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
8143055 |
aatttatgtggatttcgttaacaaattgaagagatatcccaagtactctgctttttggctgcaaaagttccttctcaagggaaaacactaaatttgatgt |
8143154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University