View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9747_high_3 (Length: 274)
Name: NF9747_high_3
Description: NF9747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9747_high_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 18 - 264
Target Start/End: Complemental strand, 40378341 - 40378095
Alignment:
| Q |
18 |
cacgtagccaatccaaaatcagagagctgaataaaatcaaagtagaccaacataaggattgattaatacaaataattcgaaatattaaaatccaatcaat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40378341 |
cacgtagccaatccaaaatcagagagctgaataaaatcaaagcagaccagcataaggattgattaatacaaataattcgaaatattaaaagccaatcaat |
40378242 |
T |
 |
| Q |
118 |
cggaagatagataaatacctgaggttcaaaatcttcggatagtaatacatttgatgattttacatcccgatgaatcacgggatgatcatctttacaatgc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40378241 |
cggaagatagataaatacctgaggttcaaaatcttcagatagtaatacattggatgattttacatcccgatgaatcacgggatgatcgtctttacaatgc |
40378142 |
T |
 |
| Q |
218 |
agatattccaaagcttcagcaacgcctgttgcaaccttatatctctg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40378141 |
agatattccaaagcttcagcaacgcctgttgcaaccttatatctctg |
40378095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 133 - 263
Target Start/End: Complemental strand, 10259696 - 10259566
Alignment:
| Q |
133 |
tacctgaggttcaaaatcttcggatagtaatacatttgatgattttacatcccgatgaatcacgggatgatcatctttacaatgcagatattccaaagct |
232 |
Q |
| |
|
|||||||||||||||||| || |||| ||| |||||||||||||||||||| ||||| ||||| || || ||| ||| ||||||||| |||||||| |
|
|
| T |
10259696 |
tacctgaggttcaaaatcctcagataataacacatttgatgattttacatcacgatggatcacaggttggtcactgttattatgcagatactccaaagcc |
10259597 |
T |
 |
| Q |
233 |
tcagcaacgcctgttgcaaccttatatctct |
263 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |
|
|
| T |
10259596 |
tcagcaacgcccattgccaccttatatctct |
10259566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University