View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9747_low_13 (Length: 226)
Name: NF9747_low_13
Description: NF9747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9747_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 7 - 220
Target Start/End: Complemental strand, 49063468 - 49063254
Alignment:
| Q |
7 |
tatcctctaatagaagtctat-ttaaaggcagaataaactttatatgcattnnnnnnnnnncatttagtaaacttcatataattattgaaaatcatcatc |
105 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49063468 |
tatcctctaatagaagtctatcttaaaggcagaataaactttatatgcattaaaaaaaacacattcagtaaacttcatataattattgaaaatcatcatc |
49063369 |
T |
 |
| Q |
106 |
atatgatatgcctttcattttaccaccaagcctcaacccacttccctctcattaataagtgattgtctacgtgtctcatcatagtcacacttaaatattt |
205 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49063368 |
atatgatatgcctttcatttttccaccaagcctcaacccacttccctctcattaataagtgattgtctacgtgtctcatcatagtcacacttaaatattt |
49063269 |
T |
 |
| Q |
206 |
gttgactttgccttt |
220 |
Q |
| |
|
||||||||| ||||| |
|
|
| T |
49063268 |
gttgactttaccttt |
49063254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University