View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9747_low_14 (Length: 215)
Name: NF9747_low_14
Description: NF9747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9747_low_14 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 12797247 - 12797064
Alignment:
| Q |
18 |
agttggactaatggaactttggaacc-ttaatccaaatataattctaaggnnnnnnnnnncttagactaatgatttcaagccttcaaatatataaaatac |
116 |
Q |
| |
|
||||||| ||||||| |||||||||| ||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12797247 |
agttggagtaatggagctttggaacccttaatccaaatataattctaaggttttttttttcttggactaatgatttcaagccttcaaatatataaaatac |
12797148 |
T |
|
| Q |
117 |
taattttgaatgtgagaatatcaaaatcttaaacctaccccaagagtattggagacccaagatcgtattttcaattgcattcat |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12797147 |
aaattttgaatgttagaatatcaaaatcttaaacctaccccaagtgtattggagacccaagatcgtattttctattgcattcat |
12797064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 18 - 66
Target Start/End: Complemental strand, 12797354 - 12797306
Alignment:
| Q |
18 |
agttggactaatggaactttggaaccttaatccaaatataattctaagg |
66 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12797354 |
agttggagtaatggaactttggaaccttaatccaaatataattctaagg |
12797306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University