View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9747_low_4 (Length: 281)
Name: NF9747_low_4
Description: NF9747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9747_low_4 |
 |  |
|
| [»] scaffold0627 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 120; Significance: 2e-61; HSPs: 9)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 125 - 275
Target Start/End: Original strand, 8546971 - 8547115
Alignment:
| Q |
125 |
gcaattaagtgtagccatgaaaagaaaaaaggattcaattgcccctgttagggctagaagaagatgcaataaaggaaaaggaaaaggaaaagttgatgag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
8546971 |
gcaattaagtgtagccatgaaaagaaaaaaggattcaattgcccctgttagggctagaagaagatgcaat------aaagaaaaaggaaaagttgatgag |
8547064 |
T |
 |
| Q |
225 |
gcagacaatcatgatgaactttgcccttattttgataatctttcatctcac |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8547065 |
gcagacaatcatgatgaactttgcccttattttgataatcttccatctcac |
8547115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 8546864 - 8546913
Alignment:
| Q |
18 |
cactgttctgattttatgtttaatcgaaacaatcttatgtgttttgctct |
67 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8546864 |
cactgttctgattttatgtttaatcgaaacaatcttatgtgttttgctct |
8546913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 125 - 205
Target Start/End: Complemental strand, 8638157 - 8638077
Alignment:
| Q |
125 |
gcaattaagtgtagccatgaaaagaaaaaaggattcaattgcccctgttagggctagaagaagatgcaataaaggaaaagg |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||||| | | || ||||||||| |||||||||||||| |||||| |
|
|
| T |
8638157 |
gcaattcagtgtagccatgaaaagaaaaaagggttcaataactcttgctagggctagcctaagatgcaataaagcaaaagg |
8638077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 125 - 205
Target Start/End: Complemental strand, 8645487 - 8645404
Alignment:
| Q |
125 |
gcaattaagtgtagccatgaaaagaaaaaaggattcaattgcccctgttagggctag---aagaagatgcaataaaggaaaagg |
205 |
Q |
| |
|
|||||| ||||||||||||||||||||||| | |||||| | |||| ||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
8645487 |
gcaattcagtgtagccatgaaaagaaaaaacggttcaataactcctgctagggctagcctaagaagaagcaataaagcaaaagg |
8645404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 134 - 275
Target Start/End: Complemental strand, 8536761 - 8536629
Alignment:
| Q |
134 |
tgtagccatgaaaagaaaaaaggattcaattgcccctgttagggctagaagaagatgcaataaaggaaaaggaaaaggaaaagttgatgaggcagacaat |
233 |
Q |
| |
|
||||| ||||||||||||||| | |||||||||||||| ||||||| | |||| ||||| ||| |||||| ||||||||||||||||| | |
|
|
| T |
8536761 |
tgtagtcatgaaaagaaaaaaaggttcaattgcccctgctagggctggccaaagacgcaat------aaatcaaaagggaaagttgatgaggcagaaagc |
8536668 |
T |
 |
| Q |
234 |
catgatgaactttgcccttattttgataatctttcatctcac |
275 |
Q |
| |
|
| || |||||||||||||||||||||||||| | |||||| |
|
|
| T |
8536667 |
c---atcaactttgcccttattttgataatcttccgtctcac |
8536629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 201 - 275
Target Start/End: Complemental strand, 9004570 - 9004499
Alignment:
| Q |
201 |
aaaggaaaaggaaaagttgatgaggcagacaatcatgatgaactttgcccttattttgataatctttcatctcac |
275 |
Q |
| |
|
|||| |||||| ||||||||||||||||| | |||||| |||||||||||| |||| ||||||| |||||||| |
|
|
| T |
9004570 |
aaagcaaaagggaaagttgatgaggcagaaagtcatga---actttgcccttactttgctaatcttccatctcac |
9004499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 220 - 275
Target Start/End: Original strand, 9073655 - 9073710
Alignment:
| Q |
220 |
atgaggcagacaatcatgatgaactttgcccttattttgataatctttcatctcac |
275 |
Q |
| |
|
|||||||||| | |||||||||||||| ||||| |||||| |||||| |||||||| |
|
|
| T |
9073655 |
atgaggcagagagtcatgatgaacttttccctttttttgacaatcttccatctcac |
9073710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 235 - 275
Target Start/End: Original strand, 1599238 - 1599278
Alignment:
| Q |
235 |
atgatgaactttgcccttattttgataatctttcatctcac |
275 |
Q |
| |
|
|||||||| ||| ||||| |||||||||||||||||||||| |
|
|
| T |
1599238 |
atgatgaagttttccctttttttgataatctttcatctcac |
1599278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 274
Target Start/End: Original strand, 2844031 - 2844067
Alignment:
| Q |
238 |
atgaactttgcccttattttgataatctttcatctca |
274 |
Q |
| |
|
|||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
2844031 |
atgaactttgcccttactttgataatcttccatctca |
2844067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 212 - 275
Target Start/End: Original strand, 48360768 - 48360831
Alignment:
| Q |
212 |
aaaagttgatgaggcagacaatcatgatgaactttgcccttattttgataatctttcatctcac |
275 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
48360768 |
aaaagttgatgaggtagagagtcatgatgaactttgcccttattttgataatcttccatatcac |
48360831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0627 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0627
Description:
Target: scaffold0627; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 137 - 210
Target Start/End: Complemental strand, 5869 - 5796
Alignment:
| Q |
137 |
agccatgaaaagaaaaaaggattcaattgcccctgttagggctagaagaagatgcaataaaggaaaaggaaaag |
210 |
Q |
| |
|
|||||||||||||||| ||| ||||||| ||||| |||||||||| ||||||||||||||| |||||| |||| |
|
|
| T |
5869 |
agccatgaaaagaaaagagggttcaattacccctattagggctagccgaagatgcaataaagcaaaagggaaag |
5796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 136 - 203
Target Start/End: Complemental strand, 16717586 - 16717519
Alignment:
| Q |
136 |
tagccatgaaaagaaaaaaggattcaattgcccctgttagggctagaagaagatgcaataaaggaaaa |
203 |
Q |
| |
|
||||||||||||||||||||| |||||| |||| || |||||||| ||||||||||||| ||||| |
|
|
| T |
16717586 |
tagccatgaaaagaaaaaagggttcaatcacccccgtaagggctagccaaagatgcaataaaagaaaa |
16717519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University