View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9747_low_5 (Length: 276)
Name: NF9747_low_5
Description: NF9747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9747_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 259
Target Start/End: Complemental strand, 24463389 - 24463131
Alignment:
| Q |
1 |
ccatgacgtttcaacctggcaaaaacagcccccaaccccatgcactggtgatcccattcccagctcaaggccacatgatacccctcctcgacctcaccca |
100 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| || ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24463389 |
ccatgacgtttcaacctgacaaaaacaacccccatccacatacactggtgatcccattcccagctcaaggccacatgatacccctcctcgaccttaccca |
24463290 |
T |
|
| Q |
101 |
caaactggcatccaccatcaccaacctcaccatcaccatcctcacaaccccaaaaaaccaatccctcttaacccctctcctcaactctcacccttcaaca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24463289 |
caaactggcatccaccatcaccaacctcaccatcaccatcctcacaaccccaaaaaaccaatccctcttaacccctctcctcaactctcacccttcaaca |
24463190 |
T |
|
| Q |
201 |
atccacccattaatcctccctttcccgtctcacccatcaatccctcgcggcatcgaaaa |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24463189 |
atccaccctttaatcctccctttcccgtctcacccatcaatccctcacggcatcgaaaa |
24463131 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University