View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9747_low_7 (Length: 254)
Name: NF9747_low_7
Description: NF9747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9747_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 17 - 240
Target Start/End: Original strand, 15053093 - 15053316
Alignment:
| Q |
17 |
aggtaagacacaaatgatgggagtgttggctcgcccatgtaggtgtaatggtggtcacggcaatgacttatgtgagaatactctctcctctacttcaatg |
116 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15053093 |
aggtaagacacaaatgatggaagtgttggctcgcccatgtaggtgtaatggtggttgcgacaatgacttatgtgagaatactctctcctctacttcaatg |
15053192 |
T |
 |
| Q |
117 |
gttgtagattgggtggttgttgtttaagtgagagttgcaacaggttttgcaggtggaagggtatagttgtttgtgcattggattctaccaattatacaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15053193 |
gttgtagattgggtggttgttgtttaagtgagagttgcaacaggttttgcaggtggaagggtatagttgtttgtgcattggattctaccaattatacaaa |
15053292 |
T |
 |
| Q |
217 |
ctgacactttgaatttcgttgtcc |
240 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
15053293 |
ctgacactttgaatttcgttgtcc |
15053316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University