View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9748_high_1 (Length: 551)
Name: NF9748_high_1
Description: NF9748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9748_high_1 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 532; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 532; E-Value: 0
Query Start/End: Original strand, 1 - 532
Target Start/End: Original strand, 56492452 - 56492983
Alignment:
| Q |
1 |
aattgtgattgggagtggtattggtggactgagttgtgcagcactgttggcaagatatgaacaagatgttgtcgttttcgaaagccacgaccatgctgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492452 |
aattgtgattgggagtggtattggtggactgagttgtgcagcactgttggcaagatatgaacaagatgttgtcgttttcgaaagccacgaccatgctgga |
56492551 |
T |
 |
| Q |
101 |
ggtgctgctcattcttttgatgtcaaaggctataagtttgattccggtccatcattattctctggtttgcagtcaagaggtccacaggctaaccctcttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492552 |
ggtgctgctcattcttttgatgtcaaaggctataagtttgattccggtccatcattattctctggtttgcagtcaagaggtccacaggctaaccctcttg |
56492651 |
T |
 |
| Q |
201 |
ctcaagttcttgatgctttgggagagtccgtcccctgcgctacttatgattcatggatggtccatgtacctgaagctgatttcttgtcacgcataggtcc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492652 |
ctcaagttcttgatgctttgggagagtccgtcccctgcgctacttatgattcatggatggtccatgtacctgaagctgatttcttgtcacgcataggtcc |
56492751 |
T |
 |
| Q |
301 |
tactgagtttttaaaggaccttcacaactatgcaggtcctgaagctgttcaagaatggcagaagcttttggatgctgtacttcccttgtctacagctgca |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492752 |
tactgagtttttaaaggaccttcacaactatgcaggtcctgaagctgttcaagaatggcagaagcttttggatgctgtacttcccttgtctacagctgca |
56492851 |
T |
 |
| Q |
401 |
atggctcttccccctctatctgttagaggagatttcggtgttctttacaccgctgctgctagatatgccccttctcttttcaatacctttttccaaatgg |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56492852 |
atggctcttccccctctatctgttagaggagatttcggtgttctttacaccgctgctgctagatatgccccttctcttttcaatacctttttccaaatgg |
56492951 |
T |
 |
| Q |
501 |
gtcctcaggctgctcttcgttccacacaactt |
532 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
56492952 |
gtcctcaggctgctcttcgttccacacaactt |
56492983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University