View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9748_high_2 (Length: 222)
Name: NF9748_high_2
Description: NF9748
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9748_high_2 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 26836048 - 26835828
Alignment:
| Q |
1 |
atatagagaatatttacggttaggaattttctccctggggcctgtctctcaagttctttgatgcttggatcattcaacatttgtcctagaacaattccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26836048 |
atatagagaatatttacggttaggtattttctccctggggcctctctctcaagttttttgatgcttggatcattcaatatttgtcctagaacaattccaa |
26835949 |
T |
|
| Q |
101 |
tttttccctttccccccaacattcatatttgtccaactcacctgtttgtctgtattcataacagataactatgtactgcattggattttgaatccgtgta |
200 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26835948 |
tttttccctttccccc-aacaatcatatttgtccaactcacctgtttgtctgtattcataacagataactatgtactgcattggtttttgaatccgtgta |
26835850 |
T |
|
| Q |
201 |
aaaaagagattttacatcactt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
26835849 |
aaaaagagattttacatcactt |
26835828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University