View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9749_high_13 (Length: 261)

Name: NF9749_high_13
Description: NF9749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9749_high_13
NF9749_high_13
[»] chr3 (1 HSPs)
chr3 (129-231)||(24084553-24084655)


Alignment Details
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 129 - 231
Target Start/End: Complemental strand, 24084655 - 24084553
Alignment:
129 tatcttaatagagggtgagattcatcagagtgaaattgaagagatagttggatatggagatgaagtggaagagaatgagatacttgaagttgaggatgga 228  Q
    |||||||||||||||||||| |||| |||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |    
24084655 tatcttaatagagggtgagactcatgagagtgaaattgaagagatagttggagatggagatgaaatggaagagaatgagatacttgaagttgaggatgaa 24084556  T
229 cta 231  Q
    |||    
24084555 cta 24084553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University