View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9749_low_16 (Length: 281)
Name: NF9749_low_16
Description: NF9749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9749_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 193 - 270
Target Start/End: Complemental strand, 47560879 - 47560802
Alignment:
| Q |
193 |
cttcattagtctttcttatttgatagatctattctcaccgccattaattacaaactacaaacagatttcttgaccttt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47560879 |
cttcattagtctttcttatttgatagatctatcctcaccgacattaattacaaactacaaacagatttcttgaccttt |
47560802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 9 - 67
Target Start/End: Complemental strand, 47561036 - 47560978
Alignment:
| Q |
9 |
cgcgtacacacccttcctgcctcagttttttcactttgaatttgaaaggtaatttcttg |
67 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47561036 |
cgcgcacacacccttcttgcctcagtttttccactttgaatttgaaaggtaatttcttg |
47560978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 138 - 182
Target Start/End: Complemental strand, 47560907 - 47560863
Alignment:
| Q |
138 |
cgtcgtcgtcacagttgctttggacatccttcattagtctttctt |
182 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
47560907 |
cgtcgtcgtcacagttgcttcggacatccttcattagtctttctt |
47560863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University