View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9749_low_18 (Length: 270)
Name: NF9749_low_18
Description: NF9749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9749_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 24 - 143
Target Start/End: Original strand, 32311375 - 32311494
Alignment:
| Q |
24 |
ttagtacataacaactccaatagagctacatgcttcgaccaaagtacaccagccacataatcaacaacactccataattaatacatgcatgacacataca |
123 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||| || |
|
|
| T |
32311375 |
ttagtacataacaactctaatagagctacatgcttcgaccaaagtacaccagccacagaatcaacaacactccataattaatacaggcatgacacatgca |
32311474 |
T |
|
| Q |
124 |
tgcatgcatatttgatacaa |
143 |
Q |
| |
|
|||||||| ||||||||||| |
|
|
| T |
32311475 |
tgcatgcacatttgatacaa |
32311494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 199 - 250
Target Start/End: Original strand, 32311694 - 32311745
Alignment:
| Q |
199 |
aagataccctcttgatgcatgtggattaggttcaatgtcggaaacattgtta |
250 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32311694 |
aagaaaccctcttgatgcatgtggattaggttcaatgtcggaaacattgtta |
32311745 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University