View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9749_low_22 (Length: 239)
Name: NF9749_low_22
Description: NF9749
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9749_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 225
Target Start/End: Complemental strand, 4786786 - 4786574
Alignment:
| Q |
14 |
agaccgtgagataaattcaattaaatccagaacacttatatgcaagtaaagttttaatacgaggaatttactagatatatataacc-taataaaattcct |
112 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4786786 |
agaccgtgagataaattaaattaaatccagaacatttatatgcaagtaaagttttaatacgaggaatttactagatatatataaccataataaaattcct |
4786687 |
T |
|
| Q |
113 |
tttctttttatgctcaaaaatttgaaaggttttcttttgaagagctaaagcctgcttgattaaataggtagaacataaacaaatctagatttttacattc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4786686 |
tttctttttatgctcaaaaatttgaaaggttttcttttgaagagctaaagcctgcttgattaaataggtagaacataaacaaatctagatttttacattc |
4786587 |
T |
|
| Q |
213 |
cttcatggtgctg |
225 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
4786586 |
cttcatagtgctg |
4786574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University