View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9750_high_11 (Length: 250)
Name: NF9750_high_11
Description: NF9750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9750_high_11 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 11 - 250
Target Start/End: Original strand, 51024367 - 51024599
Alignment:
| Q |
11 |
cataggcttagttttggctgcagatttgtgtatattaagtataatttataaacatgcagaaatagattggtgtcgaaaagcatttcaagttgactaaacc |
110 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51024367 |
cataggcttagttttggctgaagatttgtgtatattaagtata-------aacatgcagaaatagattggtgtcgaaaagcatttcaagttgactaaacc |
51024459 |
T |
|
| Q |
111 |
tgtctggtgccttttggttatattatatggctctcaagttaatatgnnnnnnnacagatcatcttctagtgctgaagcagggtctcaaacatttaatcaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51024460 |
tgtctggtgccttttggttatattatatggctctcaagttaatatgtttttttacagatcatcttctagtgctgaagcagggtctcaaacatttaatcaa |
51024559 |
T |
|
| Q |
211 |
ttgttgcttcctgcaccctctacatcaaatggttcggctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51024560 |
ttgttgcttcctgcaccctctacatcaaatggttcggctc |
51024599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 172 - 245
Target Start/End: Complemental strand, 8801773 - 8801700
Alignment:
| Q |
172 |
tcttctagtgctgaagcagggtctcaaacatttaatcaattgttgcttcctgcaccctctacatcaaatggttc |
245 |
Q |
| |
|
|||||| |||||||||||||||| |||||||| |||||||| ||||||||||||| ||||||| |||||||| |
|
|
| T |
8801773 |
tcttctggtgctgaagcagggtcccaaacattgaatcaattaatgcttcctgcaccagctacatccaatggttc |
8801700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University