View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9750_low_11 (Length: 294)
Name: NF9750_low_11
Description: NF9750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9750_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 70 - 290
Target Start/End: Complemental strand, 34646751 - 34646531
Alignment:
| Q |
70 |
aataaatgatttgaaacattagtgttttcgttttaatactacatagtattgcattacttgttaatcaagttaccatgttattttgcttgaaacagggatt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34646751 |
aataaatgatttgaaacattagtgttttcgttttaatactacatagtattgcattacttgttaatcaagttaccatgttattttgcttgaaacagggatt |
34646652 |
T |
|
| Q |
170 |
gattagtattacggtatcaactatactaccacatttccgtcctccaccatgtccaacacaagtaaattgcaaagaagcgacatcttcacaattattacca |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34646651 |
gattagtattacggtatcaactatactaccacatttccgtcctccaccatgtccaacacaagtaaattgcaaagaagccacatcttcacaattattacca |
34646552 |
T |
|
| Q |
270 |
ctctacatgtctctgctcctc |
290 |
Q |
| |
|
|||||||||||||| |||||| |
|
|
| T |
34646551 |
ctctacatgtctctcctcctc |
34646531 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 20 - 71
Target Start/End: Complemental strand, 34646834 - 34646783
Alignment:
| Q |
20 |
gttagggtttgactttataacttaaaaggacagagttcgaatcccactggaa |
71 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34646834 |
gttagggtttgactttataacttaaaaggacagagttcgaatcccactggaa |
34646783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 238
Target Start/End: Complemental strand, 34661090 - 34661036
Alignment:
| Q |
184 |
tatcaactatactaccacatttccgtcctccaccatgtccaacacaagtaaattg |
238 |
Q |
| |
|
||||||||||||| ||||| | |||||||||||||||||||| ||||| ||||| |
|
|
| T |
34661090 |
tatcaactatactcccacacatgcgtcctccaccatgtccaactcaagtgaattg |
34661036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University