View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9750_low_12 (Length: 279)
Name: NF9750_low_12
Description: NF9750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9750_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 12 - 265
Target Start/End: Complemental strand, 24558023 - 24557770
Alignment:
| Q |
12 |
gcagaacctgtgagattgaaacaaatcaacgaaaatgttaaccaattttgaagaagttagggtcgttgaaaccgcattgaaacgaacatgaagaaattaa |
111 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24558023 |
gcagaatctgtgagattgaaacaaatcaacgaaaatgttaaccaattttgaagaagttagggtcgttgaaaccgcattgaaacgaacatgaagaaattaa |
24557924 |
T |
 |
| Q |
112 |
cgttgcgtttcggagatttattgttgagagagacaatgccttcgatttttcaattttattatttggaattttcgaattcgaagagtttttggcgaatgtt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24557923 |
cgttgcgtttcggagatttattgttgagagagacaatgccttcgatttttcaattttattatttggaattttcgaattcgaagagtttttggcgaatgtt |
24557824 |
T |
 |
| Q |
212 |
gaacacgcgagaagcgataggctctgtctctctctgtctttctgagagagagat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24557823 |
gaacacgcgagaagcgataggctctgtctctctctgtctttctgagagagagat |
24557770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University