View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9750_low_13 (Length: 250)
Name: NF9750_low_13
Description: NF9750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9750_low_13 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 39737034 - 39737283
Alignment:
| Q |
1 |
tttaagcatcacgatttgggattttgatcttccactttttagatgaacaattttggtcttcatagtat----attctcaattgtatttttgaggttccac |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
39737034 |
tttaagcatcacgatttgggattttgatcttccactttttagatgaacaattttggtcttcatagtatgtatattctcaattgtatttttgaggttccgc |
39737133 |
T |
|
| Q |
97 |
tcaattttgatattgacaacacacatgttgacaacttttgtcaaagtggggacaattttgagttggaatttaatc-aattaataaaataattttgaggag |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39737134 |
tcaattttgatattgacaacacacatgttgacaacttttgtcaaagtggggacaatgttgagttggaatttaatcaaattaataaaataattttgaggag |
39737233 |
T |
|
| Q |
196 |
gaccaaatgcaaaggaatggtgacagtacaaagcatgttcctatgcttct |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39737234 |
gaccaaatgcaaaggaatggtgacagtacaaagcatgttcctatgcttct |
39737283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University