View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9750_low_20 (Length: 229)
Name: NF9750_low_20
Description: NF9750
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9750_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 10 - 226
Target Start/End: Original strand, 39736696 - 39736909
Alignment:
| Q |
10 |
tatattagccaccttggcatgatgtgattgtgacgtgctagtatccgttaatgttaagttttgtgtctttcacttgctcttaattattattaagtataga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39736696 |
tatattagccaccttggcatgatgtgattgtgacgtgctagtatccgttaatgttaagttttgtgtctttcacttgctcttaattatta---agtataga |
39736792 |
T |
|
| Q |
110 |
ttatagtatgtcattgnnnnnnntgtttgattataagcaaaatagtatattagtaatgagcaatataacagttagcgcatgaggtgccaaatgttaagca |
209 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39736793 |
ttatagtatgtcattgaaaaaactgtttgattataagcaaaatggtatattagtaatgagcaatataacagttagcgcatgaggtgccaaatgttaagca |
39736892 |
T |
|
| Q |
210 |
agagaagcacgagaatt |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
39736893 |
agagaagcacgagaatt |
39736909 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University