View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_high_16 (Length: 370)
Name: NF9751_high_16
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_high_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 8e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 18 - 167
Target Start/End: Complemental strand, 40701657 - 40701508
Alignment:
| Q |
18 |
agaactaatgaattagttagattagttcattaagttagagttacttgcaaaacaaagtaaagtagttagttagaagtttctagctgtgtttgttgtaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
40701657 |
agaactaatgaattagttagattagttcattaagttagagttacttgcaaaacaaagtaaagtagttagttagaagtttctagctgtgtttgttgtaacg |
40701558 |
T |
 |
| Q |
118 |
gtgcctgtatatgggaaataagaaataagtttccatcttaatattattgg |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40701557 |
gtgcctgtatatgggaaataagaaataagtttccatcttaatattattgg |
40701508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 22 - 72
Target Start/End: Complemental strand, 40701727 - 40701676
Alignment:
| Q |
22 |
ctaatgaatt-agttagattagttcattaagttagagttacttgcaaaacaa |
72 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40701727 |
ctaatgaatttagttagattagttcattaagttagagttacttgcaaaacaa |
40701676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University