View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_high_23 (Length: 317)
Name: NF9751_high_23
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_high_23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 44262326 - 44262020
Alignment:
| Q |
1 |
tttaaagtctaacctctcttagcttatgttgcaacactttttcatcaccattgtcaaaatccatggaaaatctcaccacactgaacattttttagataag |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262326 |
tttaaagtctaacctctcttagcttctgttgcaacactttttcatcaccattgtcaaaatccatggaaaatctcaccacactgaacattttttagataag |
44262227 |
T |
 |
| Q |
101 |
caataatttcactattggaaggtcaaggatacttacaaccttaaatgcatccatcccgaggagcttggaagttccacttccttatagacgcctcgactag |
200 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262226 |
caataatttcactattggaaggtcagggatacttacaaccttaaatgcatccatcccaaggagcttggaagttccacttccttatagacgcctcgactag |
44262127 |
T |
 |
| Q |
201 |
atgttcttgagccatggaacatccaatttactctggagagattaaagaaactcttggcagccaaggaaatctcacaacattgatacttttcaatattgct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44262126 |
atgttcttgagccatggaacatccaatttactctggagagattaaagaaactcttggcagccaaggaaatctcacaacattgatacttttcaatattgct |
44262027 |
T |
 |
| Q |
301 |
ttctctg |
307 |
Q |
| |
|
||||||| |
|
|
| T |
44262026 |
ttctctg |
44262020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University