View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_high_44 (Length: 243)
Name: NF9751_high_44
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_high_44 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 243
Target Start/End: Original strand, 9875449 - 9875683
Alignment:
| Q |
9 |
gacatcaagaaattatgccacaacttcagctagcagagggtatattattcataaacttatatttcgtccaataagcaattgatgatcttaaactatgtct |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9875449 |
gacatcaagaaattatgccacaacttcagctagcagagggtatattattcataaacttatatttcgtccaataagtaattgatgatcttaaactatgtct |
9875548 |
T |
|
| Q |
109 |
gtgacttcataattatcatgtaaccctagatcccctcgtgtacattttattggttgaattattattgaactataaaactgagtgggtgacccataatgag |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
9875549 |
gtgacttcataattatcatgtaaccctagatcccctcgtgtacattttattggttgaattattattgaaccataaaactgagtgggtaacccataatgag |
9875648 |
T |
|
| Q |
209 |
ttcaagcacgtttacaatctaataacaagaacttt |
243 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
9875649 |
ttcaagcacgtttacaatctaaaaacaagaacttt |
9875683 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University