View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_22 (Length: 413)
Name: NF9751_low_22
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 400; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 400; E-Value: 0
Query Start/End: Original strand, 1 - 408
Target Start/End: Original strand, 7910572 - 7910979
Alignment:
| Q |
1 |
agctacattttcattctcatctcaatttgctccctaacgtatcatctgcttgcaataagattagacatgtcatacatttctcggacatgtgggtggggtt |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7910572 |
agctaaattttcattctcatctcaatttgctccctaacgtatcatctacttgcaataagattagacatgtcatacatttctcggacatgtgggtggggtt |
7910671 |
T |
 |
| Q |
101 |
cagccccagcaaagaactcgtgggcaacaccatttagggtgatggtactgcatcctggaagatttagcagacccttattttttatatggcttctcacttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7910672 |
cagccccagcaaagaactcgtgggcaacaccatttagggtgatggtactgcatcctggaagatttagcagacccttattttttatatggcttctcacttg |
7910771 |
T |
 |
| Q |
201 |
actcgcttcatcccattctccagctgcagcatgaatgcttgccaaatgaatataccggccatcatgttcagggtccaattcaatcagaaatttgccaatc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7910772 |
actcgcttcatcccattctccagctgcagcatgaatgcttgccaaatgaatataccggccatcatgttcagggtccaattcaatcagaaatttgccaatc |
7910871 |
T |
 |
| Q |
301 |
tctttgccaagctcaagatgtttgtgcaggtggcaggcattgagcagtgatccccatattgcagcatttggttttatgggcatggactctacaaactcct |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7910872 |
tctttgccaagctcaagatgtttgtgcaggtggcaggcattgagcagtgatccccatattgcagcatttggttttatgggcatggactctacaaactcct |
7910971 |
T |
 |
| Q |
401 |
ttgcttct |
408 |
Q |
| |
|
|||||||| |
|
|
| T |
7910972 |
ttgcttct |
7910979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University