View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_28 (Length: 393)
Name: NF9751_low_28
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_28 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 20 - 376
Target Start/End: Original strand, 30655089 - 30655451
Alignment:
| Q |
20 |
acctatgggtgttgatgtggtgttttgtatggtgttttggggttgttacggtggcttgaaagagcggtggtgaagtgttataggtgtttgcttgggtgtg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
30655089 |
acctatgggtgttgatgtggtgttttgtatggtgttttggggttgttacggtggcttgaaagagtggtggtgaagtgttataggtgtttgcttgggcgtg |
30655188 |
T |
 |
| Q |
120 |
g------tggttgcatcttttgggtggtattagctcttaaggggttttaaaggtggattttttgttgagttatgggtgttgatcatataggttgagggtg |
213 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
30655189 |
gtagtggtggttgcatcttttgggtggtattagctcttaaggggttttaaaggtggagtttttgctgagttatgggtgttgatcatataggttgagggtg |
30655288 |
T |
 |
| Q |
214 |
ttgaggaaagggaggcataatcgtacatcaattggtattattgttattttgttgggtgttggttgattgtgattagaatctcgcgtttgtttggttagta |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30655289 |
ttgaggaaagggaggcataatcgtacatcaattggtgttattgttattttgttgggtgttggttgattgtgattagaatctcgcgtttgtttggttagta |
30655388 |
T |
 |
| Q |
314 |
actgaagttgttgtgaccgtggatatggatccttctttgtcgctgcttactcgtgtttgtttg |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
30655389 |
actgaagttgttgtgaccgtggatatggatccttctttgtcgctgcttgctcgtgtttgtttg |
30655451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 73; Significance: 3e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 23 - 115
Target Start/End: Original strand, 38928911 - 38929003
Alignment:
| Q |
23 |
tatgggtgttgatgtggtgttttgtatggtgttttggggttgttacggtggcttgaaagagcggtggtgaagtgttataggtgtttgcttggg |
115 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38928911 |
tatgggtgttgatgtgaggttttgtacggtgttttggggttgttatggtggcttgaaagagcgatggtgaagtgttataggtgtttgcttggg |
38929003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University