View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_63 (Length: 250)
Name: NF9751_low_63
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_63 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 41555142 - 41555374
Alignment:
| Q |
1 |
taatcacagtagccgatccaaatcctaggaattaatagggacctcgttttttatttcaccaacataactgnnnnnnnnnnnnnnnnnngacatctctcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| || |
|
|
| T |
41555142 |
taatcacagtagccgatccaaatcctaggaattaatagggacctcgttttttatttcaccaacataactgttttttctgtctttttt-gacatctctgaa |
41555240 |
T |
 |
| Q |
101 |
cttcaaaggataagataaatgtgacaaatacagtggtaaaatatcttggtggtacgtccatggtggggagggggttaaactgcaaaagaaatgatacaat |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41555241 |
cttcaaaggttaagataaatgtgacaaatacagtggtaaaatatcttggtggtacgtccatggtggggagggggttaaactgcaaaagaaatgatacaat |
41555340 |
T |
 |
| Q |
201 |
atagtaatatatttcattaagcttcaatttgtggccttt |
239 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
41555341 |
atag-----tatttcattaagcttcaatttgtggccttt |
41555374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University