View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_66 (Length: 250)
Name: NF9751_low_66
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_66 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 250
Target Start/End: Complemental strand, 39441341 - 39441101
Alignment:
| Q |
11 |
cagagaggattgaaaat-agtgtaaacggggctcatattattggcaataggtgtcagccacacaacatgagtttttagaatgaattttgaagctgaaatt |
109 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39441341 |
cagagaggattgaaaattagtgtaaacggggctcatattattggcaataggtgtcagccacacaacatgagtttttagaatgaattttgaagctgaaatt |
39441242 |
T |
|
| Q |
110 |
tacaaaacttgactcagaagccaatgcgtaaagaaccaattgatactgtcctaaccaattgttactagtaatttctcctaacctatatccacagcaaaca |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39441241 |
tacaaaacttgactcagaagccaatgcgtaaagaaccaattgatactgtcctaaccaattgttactagtaatttctcctaacctatatccacagcaaaca |
39441142 |
T |
|
| Q |
210 |
ttatgaactcagagagnnnnnnnnttagttatcaacaattc |
250 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||| |
|
|
| T |
39441141 |
ttatgaactcagggagaaaaaaaattagttatcaacaattc |
39441101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University