View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_70 (Length: 247)
Name: NF9751_low_70
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_70 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 31 - 231
Target Start/End: Original strand, 6339310 - 6339504
Alignment:
| Q |
31 |
aattattggatattatatattgttatctaccgtttattcggtttgtttgaatcaattctaagaaattgatcagttatttggacgcttaaatactttggaa |
130 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
6339310 |
aattaatggatattatatattgttatctacggtttattcggtttgtttgaatcaattctaagatattggtcagttatttggaagcttaaatactttggaa |
6339409 |
T |
 |
| Q |
131 |
cttagtttggaggatatgccgggttgtttatctacgactacgacggtttgacttcatgacaaaggtgtgatgtgtccaacacattgcgttagttgtgttt |
230 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||| | || ||| ||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6339410 |
cttagtttggaggatgtgccgggttgtttat------ctacgaggattcgacatcatgacaaaggtgtgatgtgtctaacacattgcgttagttgtgttt |
6339503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 31 - 232
Target Start/End: Original strand, 6330602 - 6330798
Alignment:
| Q |
31 |
aattattggatattatatattgttatctaccgtttattcgg-tttgtttgaatcaattctaagaaattgatcagttatttggacgcttaaatactttgga |
129 |
Q |
| |
|
||||| ||||||||||||| | |||||||| |||||||||| |||||||||| |||||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
6330602 |
aattaatggatattatatacttttatctacggtttattcgggtttgtttgaaacaattctaagaaattggtcagctatttggaagcttaaatactttgga |
6330701 |
T |
 |
| Q |
130 |
acttagtttggaggatatgccgggttgtttatctacgactacgacggtttgacttcatgacaaaggtgtgatgtgtccaacacattgcgttagttgtgtt |
229 |
Q |
| |
|
|||||||||||||||| || |||||||||| | ||| || | || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6330702 |
acttagtttggaggatgtgtcgggttgttt------gtctaggaggattcgacttcatgacaaaggtgtgatgtgtccaacacattgcgttagttgtgtt |
6330795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University