View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9751_low_71 (Length: 245)
Name: NF9751_low_71
Description: NF9751
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9751_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 2 - 199
Target Start/End: Complemental strand, 33352467 - 33352270
Alignment:
| Q |
2 |
tgattcaaatatttactctcaagacttcgccactgatcataaacaaacattgaaaacagagaaaattaatgaattagaatagaaaccaacataaaaacct |
101 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33352467 |
tgattcaaatatttactttcaagacttcgccactgatcataaacaaacattgaaaacaaagaaaattaatgaattcgaatagaaaccaacataaaaacct |
33352368 |
T |
|
| Q |
102 |
cttaatgttgtgatgaaaatggaagaaacaaacgtaatactttcctcttcactcagtcttgaacacaaattgcaggttgcaagcaatgagatgatttt |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33352367 |
cttaatgttgtgatgaaaatggaagaaacaaacgtaacactttcctcttcactcagtcttgaacacaaattgcaggttgcaagcaatgagatgatttt |
33352270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University